Incidental Mutation 'R4910:Sycp2'
ID379363
Institutional Source Beutler Lab
Gene Symbol Sycp2
Ensembl Gene ENSMUSG00000060445
Gene Namesynaptonemal complex protein 2
Synonyms3830402K23Rik, 4930518F03Rik
MMRRC Submission 042512-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4910 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location178345293-178407685 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 178358224 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 986 (D986E)
Ref Sequence ENSEMBL: ENSMUSP00000079909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081134]
Predicted Effect probably benign
Transcript: ENSMUST00000081134
AA Change: D986E

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445
AA Change: D986E

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132611
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.6%
  • 20x: 86.1%
Validation Efficiency 95% (144/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are sterile due to lack of axial element formation and subsequent failure of chromosome synapsis in prophase I spermatocytes, while females are subfertile with a sharply reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,998,199 T3016K probably damaging Het
Adam3 T A 8: 24,694,305 I560L probably benign Het
Agxt T C 1: 93,135,714 F113L probably benign Het
Aknad1 T A 3: 108,781,252 probably null Het
Alpk2 T A 18: 65,266,286 K2074* probably null Het
Apob A G 12: 8,007,848 Y2077C probably damaging Het
Arhgap17 A T 7: 123,308,377 L254Q probably damaging Het
Arhgap26 T A 18: 38,993,637 probably benign Het
Arhgef5 A G 6: 43,272,828 D171G probably benign Het
Arid1b T A 17: 5,342,203 S2003T probably damaging Het
Armc5 T G 7: 128,240,728 L406R possibly damaging Het
Arsb T C 13: 93,771,977 V67A probably benign Het
Aspm A G 1: 139,491,543 Y2982C probably damaging Het
Btbd7 A G 12: 102,808,048 L487P probably damaging Het
Card11 C G 5: 140,874,414 D1063H probably damaging Het
Ccdc186 G A 19: 56,798,691 T615M probably damaging Het
Cd101 T A 3: 100,993,889 T960S probably benign Het
Cdca7l C A 12: 117,873,785 S191* probably null Het
Cemip A T 7: 83,997,411 I143N probably damaging Het
Cep170 C T 1: 176,782,263 E161K possibly damaging Het
Chrm2 A T 6: 36,524,233 T342S probably benign Het
Cib2 A G 9: 54,549,879 F34L probably benign Het
Cnot1 A T 8: 95,733,231 I1836N probably benign Het
Col4a3 C A 1: 82,672,679 P552Q unknown Het
Cp T A 3: 19,989,224 probably benign Het
Cul3 C T 1: 80,290,089 V112I probably benign Het
Dcdc5 A G 2: 106,365,550 noncoding transcript Het
Disp1 A T 1: 183,135,463 V133E probably damaging Het
Dlg4 A G 11: 70,030,925 D30G probably damaging Het
Dopey1 C T 9: 86,492,061 T191I probably damaging Het
Enam T G 5: 88,502,314 S561A probably benign Het
Fbxw8 G T 5: 118,125,027 probably null Het
Filip1 A G 9: 79,817,932 V1135A probably benign Het
Galnt6 T C 15: 100,716,178 T81A probably benign Het
Ghdc T C 11: 100,766,988 K472E probably benign Het
Gm10568 T G 1: 3,680,941 noncoding transcript Het
Gm4788 T G 1: 139,774,563 D61A probably damaging Het
Gm4953 T A 1: 159,168,359 noncoding transcript Het
Gm6871 T A 7: 41,573,592 H24L probably benign Het
Gm8298 T A 3: 59,869,014 probably null Het
Gpr155 G A 2: 73,367,538 Q413* probably null Het
Grhl2 A G 15: 37,291,676 probably null Het
Ighv1-31 G C 12: 114,829,508 S36* probably null Het
Ighv8-5 A G 12: 115,067,842 S26P probably damaging Het
Igkv17-134 A C 6: 67,720,926 probably benign Het
Igkv5-48 A C 6: 69,726,849 L24R probably damaging Het
Isg20l2 T A 3: 87,939,263 V340E probably damaging Het
Lrrtm1 A G 6: 77,244,901 Y447C probably damaging Het
Ltbp1 T C 17: 75,327,292 S855P probably damaging Het
Mgat4e A T 1: 134,541,864 N147K probably damaging Het
Mlc1 A G 15: 88,958,212 L315P possibly damaging Het
Mrgpra2a A G 7: 47,426,544 V322A probably benign Het
Mroh7 T C 4: 106,709,955 probably null Het
Mybpc1 T A 10: 88,555,724 K304* probably null Het
Nlrp14 A C 7: 107,186,583 D622A possibly damaging Het
Nlrp1b T A 11: 71,217,277 H466L probably benign Het
Nlrp4d T A 7: 10,378,409 noncoding transcript Het
Nrxn3 A G 12: 89,260,360 E628G possibly damaging Het
Nup133 T C 8: 123,927,131 R530G possibly damaging Het
Nup98 A G 7: 102,195,800 S21P unknown Het
Olfr1307 A T 2: 111,945,078 I126K possibly damaging Het
Olfr168 T C 16: 19,530,018 T301A probably benign Het
Olfr173 T A 16: 58,797,442 T135S probably benign Het
Olfr251 T A 9: 38,378,742 V287E probably null Het
Olfr671 G A 7: 104,975,479 P169S possibly damaging Het
Olfr753-ps1 T C 17: 37,170,043 I202V probably benign Het
Olfr798 T C 10: 129,625,807 T85A probably damaging Het
Otog A T 7: 46,264,062 Y773F probably damaging Het
Otog A T 7: 46,298,534 I2320F probably damaging Het
Otogl T C 10: 107,879,517 S433G probably benign Het
Pcdhb17 A T 18: 37,485,159 M1L possibly damaging Het
Pde7b T A 10: 20,724,734 probably benign Het
Pgm2 T C 4: 99,963,527 V207A probably damaging Het
Pkd1 T A 17: 24,572,687 V1116E probably damaging Het
Pkd1l1 T A 11: 8,929,360 Y497F possibly damaging Het
Pomgnt2 T C 9: 121,982,947 N256S probably benign Het
Pot1a A T 6: 25,746,021 probably benign Het
Prdm9 T C 17: 15,544,323 T732A probably benign Het
Prg4 T A 1: 150,455,823 probably benign Het
Ptpro T C 6: 137,368,338 V114A probably damaging Het
Pyurf A G 6: 57,691,948 S20P unknown Het
Rasgrf1 A G 9: 89,976,752 T488A probably benign Het
Rassf8 A T 6: 145,815,280 K111* probably null Het
Reps1 A T 10: 18,107,688 E426D probably damaging Het
Robo2 T C 16: 73,933,778 K982R probably damaging Het
Rps23 T C 13: 90,923,752 probably null Het
Scamp4 T A 10: 80,609,671 V56E probably damaging Het
Serpina1c C T 12: 103,895,032 V408I probably benign Het
Sigirr A G 7: 141,093,788 W49R probably damaging Het
Slc17a6 A T 7: 51,658,741 H271L possibly damaging Het
Slc7a5 G T 8: 121,885,122 T389K probably damaging Het
Slf1 T A 13: 77,043,880 H945L probably benign Het
Slit3 T C 11: 35,632,722 S662P probably damaging Het
Snta1 C A 2: 154,377,018 E466* probably null Het
Sowaha A G 11: 53,478,445 L488P probably damaging Het
Spata17 C A 1: 187,194,011 V41F probably damaging Het
Spta1 T A 1: 174,217,863 probably null Het
Srrm2 T A 17: 23,815,388 probably benign Het
Stard13 T C 5: 151,062,527 N388S probably benign Het
Stmn3 T C 2: 181,308,837 K59E probably damaging Het
Sval1 A G 6: 41,955,444 N76S probably benign Het
Svep1 T C 4: 58,096,276 H1448R possibly damaging Het
Sytl5 C T X: 9,915,602 P181L possibly damaging Het
Tbkbp1 G A 11: 97,139,130 S400L probably benign Het
Tesc G T 5: 118,056,466 probably benign Het
Tjp1 C T 7: 65,343,727 G33R probably damaging Het
Tlr11 C A 14: 50,362,889 F777L probably benign Het
Tmem156 A G 5: 65,091,462 probably benign Het
Top3a A G 11: 60,752,378 probably benign Het
Tpcn1 A G 5: 120,556,519 W162R probably damaging Het
Tpd52l2 A T 2: 181,515,212 probably benign Het
Trim80 G A 11: 115,446,455 G381D probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn2r117 TC T 17: 23,479,513 probably null Het
Vmn2r56 T A 7: 12,715,535 I259F possibly damaging Het
Vmn2r59 T C 7: 42,043,653 T508A probably benign Het
Wdr73 A G 7: 80,891,708 V362A probably damaging Het
Zdhhc21 G T 4: 82,820,331 T207K possibly damaging Het
Zfp120 T A 2: 150,117,952 Q150L probably damaging Het
Zfp212 C A 6: 47,931,499 Q471K possibly damaging Het
Zfp804b C T 5: 6,770,540 G841D possibly damaging Het
Znfx1 A T 2: 167,036,804 M1884K probably damaging Het
Znfx1 G T 2: 167,037,482 A1658D probably benign Het
Other mutations in Sycp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Sycp2 APN 2 178382348 missense probably damaging 1.00
IGL00578:Sycp2 APN 2 178350822 splice site probably benign
IGL00646:Sycp2 APN 2 178374459 missense probably benign 0.00
IGL01309:Sycp2 APN 2 178358111 missense probably benign 0.15
IGL01464:Sycp2 APN 2 178401632 missense probably damaging 0.96
IGL01539:Sycp2 APN 2 178374695 missense probably damaging 1.00
IGL01670:Sycp2 APN 2 178378050 missense probably benign 0.00
IGL02138:Sycp2 APN 2 178358254 missense probably benign 0.31
IGL02138:Sycp2 APN 2 178401990 nonsense probably null
IGL02630:Sycp2 APN 2 178401919 missense probably damaging 1.00
IGL02673:Sycp2 APN 2 178394211 missense possibly damaging 0.63
IGL02961:Sycp2 APN 2 178380862 missense probably benign 0.01
IGL03084:Sycp2 APN 2 178391791 unclassified probably benign
IGL03123:Sycp2 APN 2 178352479 nonsense probably null
IGL03167:Sycp2 APN 2 178379498 missense probably damaging 0.99
R0043:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0050:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0310:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0363:Sycp2 UTSW 2 178346411 splice site probably benign
R0456:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0597:Sycp2 UTSW 2 178356580 missense possibly damaging 0.54
R0608:Sycp2 UTSW 2 178382404 missense probably damaging 0.98
R1112:Sycp2 UTSW 2 178352536 missense probably benign 0.05
R1127:Sycp2 UTSW 2 178374366 missense possibly damaging 0.72
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1413:Sycp2 UTSW 2 178347797 missense probably benign 0.00
R1557:Sycp2 UTSW 2 178395216 unclassified probably benign
R1562:Sycp2 UTSW 2 178382385 missense probably damaging 1.00
R1585:Sycp2 UTSW 2 178351668 missense possibly damaging 0.50
R1932:Sycp2 UTSW 2 178381957 missense probably damaging 1.00
R1950:Sycp2 UTSW 2 178402800 missense probably benign 0.00
R2001:Sycp2 UTSW 2 178378055 missense probably benign 0.05
R2105:Sycp2 UTSW 2 178350138 splice site probably null
R2382:Sycp2 UTSW 2 178378018 critical splice donor site probably null
R2403:Sycp2 UTSW 2 178403735 nonsense probably null
R2483:Sycp2 UTSW 2 178374595 missense probably damaging 0.98
R3003:Sycp2 UTSW 2 178358123 missense probably benign 0.01
R3418:Sycp2 UTSW 2 178401653 splice site probably benign
R3686:Sycp2 UTSW 2 178374384 missense probably benign 0.16
R4038:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4039:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4272:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R4343:Sycp2 UTSW 2 178380947 missense probably damaging 0.99
R4491:Sycp2 UTSW 2 178374985 missense probably damaging 1.00
R4534:Sycp2 UTSW 2 178355009 missense probably damaging 1.00
R4720:Sycp2 UTSW 2 178374432 missense probably benign 0.11
R4805:Sycp2 UTSW 2 178393961 unclassified probably benign
R4807:Sycp2 UTSW 2 178393961 unclassified probably benign
R4808:Sycp2 UTSW 2 178393961 unclassified probably benign
R4906:Sycp2 UTSW 2 178403657 critical splice donor site probably null
R5282:Sycp2 UTSW 2 178403761 missense probably damaging 1.00
R5285:Sycp2 UTSW 2 178392398 splice site probably null
R5316:Sycp2 UTSW 2 178356503 missense probably benign 0.00
R5389:Sycp2 UTSW 2 178377702 splice site probably null
R5621:Sycp2 UTSW 2 178381918 missense probably benign 0.05
R5652:Sycp2 UTSW 2 178358705 splice site probably null
R5880:Sycp2 UTSW 2 178374470 missense possibly damaging 0.92
R6114:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6115:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6186:Sycp2 UTSW 2 178383560 missense probably damaging 0.97
R6351:Sycp2 UTSW 2 178363416 missense probably damaging 1.00
R6509:Sycp2 UTSW 2 178395894 missense probably damaging 1.00
R6536:Sycp2 UTSW 2 178351648 missense probably damaging 1.00
R6679:Sycp2 UTSW 2 178380928 missense probably damaging 0.96
R6687:Sycp2 UTSW 2 178354960 missense probably damaging 0.99
R6761:Sycp2 UTSW 2 178374351 splice site probably null
R6786:Sycp2 UTSW 2 178383552 missense possibly damaging 0.63
Z1088:Sycp2 UTSW 2 178374367 missense probably benign
Z1088:Sycp2 UTSW 2 178381934 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTTGAGCTTAAGATAGAACTGCTC -3'
(R):5'- ACGCACACACTTAAAGTTGAAG -3'

Sequencing Primer
(F):5'- CTGCTCACAGTAATTAACCATCTAC -3'
(R):5'- CTGGTCATCTTAGATATTGCATGATG -3'
Posted On2016-04-15