Incidental Mutation 'R4910:Otogl'
ID379425
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission 042512-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R4910 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107879517 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 433 (S433G)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
Predicted Effect probably benign
Transcript: ENSMUST00000165341
AA Change: S433G

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: S433G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.6%
  • 20x: 86.1%
Validation Efficiency 95% (144/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,998,199 T3016K probably damaging Het
Adam3 T A 8: 24,694,305 I560L probably benign Het
Agxt T C 1: 93,135,714 F113L probably benign Het
Aknad1 T A 3: 108,781,252 probably null Het
Alpk2 T A 18: 65,266,286 K2074* probably null Het
Apob A G 12: 8,007,848 Y2077C probably damaging Het
Arhgap17 A T 7: 123,308,377 L254Q probably damaging Het
Arhgap26 T A 18: 38,993,637 probably benign Het
Arhgef5 A G 6: 43,272,828 D171G probably benign Het
Arid1b T A 17: 5,342,203 S2003T probably damaging Het
Armc5 T G 7: 128,240,728 L406R possibly damaging Het
Arsb T C 13: 93,771,977 V67A probably benign Het
Aspm A G 1: 139,491,543 Y2982C probably damaging Het
Btbd7 A G 12: 102,808,048 L487P probably damaging Het
Card11 C G 5: 140,874,414 D1063H probably damaging Het
Ccdc186 G A 19: 56,798,691 T615M probably damaging Het
Cd101 T A 3: 100,993,889 T960S probably benign Het
Cdca7l C A 12: 117,873,785 S191* probably null Het
Cemip A T 7: 83,997,411 I143N probably damaging Het
Cep170 C T 1: 176,782,263 E161K possibly damaging Het
Chrm2 A T 6: 36,524,233 T342S probably benign Het
Cib2 A G 9: 54,549,879 F34L probably benign Het
Cnot1 A T 8: 95,733,231 I1836N probably benign Het
Col4a3 C A 1: 82,672,679 P552Q unknown Het
Cp T A 3: 19,989,224 probably benign Het
Cul3 C T 1: 80,290,089 V112I probably benign Het
Dcdc5 A G 2: 106,365,550 noncoding transcript Het
Disp1 A T 1: 183,135,463 V133E probably damaging Het
Dlg4 A G 11: 70,030,925 D30G probably damaging Het
Dopey1 C T 9: 86,492,061 T191I probably damaging Het
Enam T G 5: 88,502,314 S561A probably benign Het
Fbxw8 G T 5: 118,125,027 probably null Het
Filip1 A G 9: 79,817,932 V1135A probably benign Het
Galnt6 T C 15: 100,716,178 T81A probably benign Het
Ghdc T C 11: 100,766,988 K472E probably benign Het
Gm10568 T G 1: 3,680,941 noncoding transcript Het
Gm4788 T G 1: 139,774,563 D61A probably damaging Het
Gm4953 T A 1: 159,168,359 noncoding transcript Het
Gm6871 T A 7: 41,573,592 H24L probably benign Het
Gm8298 T A 3: 59,869,014 probably null Het
Gpr155 G A 2: 73,367,538 Q413* probably null Het
Grhl2 A G 15: 37,291,676 probably null Het
Ighv1-31 G C 12: 114,829,508 S36* probably null Het
Ighv8-5 A G 12: 115,067,842 S26P probably damaging Het
Igkv17-134 A C 6: 67,720,926 probably benign Het
Igkv5-48 A C 6: 69,726,849 L24R probably damaging Het
Isg20l2 T A 3: 87,939,263 V340E probably damaging Het
Lrrtm1 A G 6: 77,244,901 Y447C probably damaging Het
Ltbp1 T C 17: 75,327,292 S855P probably damaging Het
Mgat4e A T 1: 134,541,864 N147K probably damaging Het
Mlc1 A G 15: 88,958,212 L315P possibly damaging Het
Mrgpra2a A G 7: 47,426,544 V322A probably benign Het
Mroh7 T C 4: 106,709,955 probably null Het
Mybpc1 T A 10: 88,555,724 K304* probably null Het
Nlrp14 A C 7: 107,186,583 D622A possibly damaging Het
Nlrp1b T A 11: 71,217,277 H466L probably benign Het
Nlrp4d T A 7: 10,378,409 noncoding transcript Het
Nrxn3 A G 12: 89,260,360 E628G possibly damaging Het
Nup133 T C 8: 123,927,131 R530G possibly damaging Het
Nup98 A G 7: 102,195,800 S21P unknown Het
Olfr1307 A T 2: 111,945,078 I126K possibly damaging Het
Olfr168 T C 16: 19,530,018 T301A probably benign Het
Olfr173 T A 16: 58,797,442 T135S probably benign Het
Olfr251 T A 9: 38,378,742 V287E probably null Het
Olfr671 G A 7: 104,975,479 P169S possibly damaging Het
Olfr753-ps1 T C 17: 37,170,043 I202V probably benign Het
Olfr798 T C 10: 129,625,807 T85A probably damaging Het
Otog A T 7: 46,264,062 Y773F probably damaging Het
Otog A T 7: 46,298,534 I2320F probably damaging Het
Pcdhb17 A T 18: 37,485,159 M1L possibly damaging Het
Pde7b T A 10: 20,724,734 probably benign Het
Pgm2 T C 4: 99,963,527 V207A probably damaging Het
Pkd1 T A 17: 24,572,687 V1116E probably damaging Het
Pkd1l1 T A 11: 8,929,360 Y497F possibly damaging Het
Pomgnt2 T C 9: 121,982,947 N256S probably benign Het
Pot1a A T 6: 25,746,021 probably benign Het
Prdm9 T C 17: 15,544,323 T732A probably benign Het
Prg4 T A 1: 150,455,823 probably benign Het
Ptpro T C 6: 137,368,338 V114A probably damaging Het
Pyurf A G 6: 57,691,948 S20P unknown Het
Rasgrf1 A G 9: 89,976,752 T488A probably benign Het
Rassf8 A T 6: 145,815,280 K111* probably null Het
Reps1 A T 10: 18,107,688 E426D probably damaging Het
Robo2 T C 16: 73,933,778 K982R probably damaging Het
Rps23 T C 13: 90,923,752 probably null Het
Scamp4 T A 10: 80,609,671 V56E probably damaging Het
Serpina1c C T 12: 103,895,032 V408I probably benign Het
Sigirr A G 7: 141,093,788 W49R probably damaging Het
Slc17a6 A T 7: 51,658,741 H271L possibly damaging Het
Slc7a5 G T 8: 121,885,122 T389K probably damaging Het
Slf1 T A 13: 77,043,880 H945L probably benign Het
Slit3 T C 11: 35,632,722 S662P probably damaging Het
Snta1 C A 2: 154,377,018 E466* probably null Het
Sowaha A G 11: 53,478,445 L488P probably damaging Het
Spata17 C A 1: 187,194,011 V41F probably damaging Het
Spta1 T A 1: 174,217,863 probably null Het
Srrm2 T A 17: 23,815,388 probably benign Het
Stard13 T C 5: 151,062,527 N388S probably benign Het
Stmn3 T C 2: 181,308,837 K59E probably damaging Het
Sval1 A G 6: 41,955,444 N76S probably benign Het
Svep1 T C 4: 58,096,276 H1448R possibly damaging Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Sytl5 C T X: 9,915,602 P181L possibly damaging Het
Tbkbp1 G A 11: 97,139,130 S400L probably benign Het
Tesc G T 5: 118,056,466 probably benign Het
Tjp1 C T 7: 65,343,727 G33R probably damaging Het
Tlr11 C A 14: 50,362,889 F777L probably benign Het
Tmem156 A G 5: 65,091,462 probably benign Het
Top3a A G 11: 60,752,378 probably benign Het
Tpcn1 A G 5: 120,556,519 W162R probably damaging Het
Tpd52l2 A T 2: 181,515,212 probably benign Het
Trim80 G A 11: 115,446,455 G381D probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn2r117 TC T 17: 23,479,513 probably null Het
Vmn2r56 T A 7: 12,715,535 I259F possibly damaging Het
Vmn2r59 T C 7: 42,043,653 T508A probably benign Het
Wdr73 A G 7: 80,891,708 V362A probably damaging Het
Zdhhc21 G T 4: 82,820,331 T207K possibly damaging Het
Zfp120 T A 2: 150,117,952 Q150L probably damaging Het
Zfp212 C A 6: 47,931,499 Q471K possibly damaging Het
Zfp804b C T 5: 6,770,540 G841D possibly damaging Het
Znfx1 A T 2: 167,036,804 M1884K probably damaging Het
Znfx1 G T 2: 167,037,482 A1658D probably benign Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1664:Otogl UTSW 10 107806576 missense probably benign 0.00
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1764:Otogl UTSW 10 107899461 nonsense probably null
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1875:Otogl UTSW 10 107899590 missense probably damaging 1.00
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R1986:Otogl UTSW 10 107794190 critical splice acceptor site probably null
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2117:Otogl UTSW 10 107858918 missense probably benign 0.06
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2508:Otogl UTSW 10 107874500 missense probably damaging 0.99
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5690:Otogl UTSW 10 107777117 synonymous silent
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6226:Otogl UTSW 10 107771206 nonsense probably null
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6727:Otogl UTSW 10 107777117 synonymous silent
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6795:Otogl UTSW 10 107777117 synonymous silent
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACTGCATCTCAGAATTTGC -3'
(R):5'- AACTGAGAGCTAGGTTTCTACTTC -3'

Sequencing Primer
(F):5'- TTTGCAGATAAAAATTAGCAACGGG -3'
(R):5'- CTAGAGTACTCATTGACAGTCTAGG -3'
Posted On2016-04-15