Incidental Mutation 'R4910:Pkd1'
ID379457
Institutional Source Beutler Lab
Gene Symbol Pkd1
Ensembl Gene ENSMUSG00000032855
Gene Namepolycystin 1, transient receptor poteintial channel interacting
SynonymsPC-1, polycystin-1, PC1
MMRRC Submission 042512-MU
Accession Numbers

Ncbi RefSeq: NM_013630.2; MGI:97603

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4910 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24549834-24596508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24572687 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1116 (V1116E)
Ref Sequence ENSEMBL: ENSMUSP00000049296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000228745]
Predicted Effect probably damaging
Transcript: ENSMUST00000035565
AA Change: V1116E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855
AA Change: V1116E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227107
Predicted Effect probably benign
Transcript: ENSMUST00000228745
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.6%
  • 20x: 86.1%
Validation Efficiency 95% (144/151)
MGI Phenotype Strain: Several; see below
Lethality: E13-E15
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutant embryos begin to die after embryonic day (E) 14.5. They develop edema by E13.5, pancreatic cysts by E15.5 and kidney cysts by E16.5. Heterozygous adults develop cysts of the kidneys (~20-30%) and the liver (~10%) late in life. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(28) Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,998,199 T3016K probably damaging Het
Adam3 T A 8: 24,694,305 I560L probably benign Het
Agxt T C 1: 93,135,714 F113L probably benign Het
Aknad1 T A 3: 108,781,252 probably null Het
Alpk2 T A 18: 65,266,286 K2074* probably null Het
Apob A G 12: 8,007,848 Y2077C probably damaging Het
Arhgap17 A T 7: 123,308,377 L254Q probably damaging Het
Arhgap26 T A 18: 38,993,637 probably benign Het
Arhgef5 A G 6: 43,272,828 D171G probably benign Het
Arid1b T A 17: 5,342,203 S2003T probably damaging Het
Armc5 T G 7: 128,240,728 L406R possibly damaging Het
Arsb T C 13: 93,771,977 V67A probably benign Het
Aspm A G 1: 139,491,543 Y2982C probably damaging Het
Btbd7 A G 12: 102,808,048 L487P probably damaging Het
Card11 C G 5: 140,874,414 D1063H probably damaging Het
Ccdc186 G A 19: 56,798,691 T615M probably damaging Het
Cd101 T A 3: 100,993,889 T960S probably benign Het
Cdca7l C A 12: 117,873,785 S191* probably null Het
Cemip A T 7: 83,997,411 I143N probably damaging Het
Cep170 C T 1: 176,782,263 E161K possibly damaging Het
Chrm2 A T 6: 36,524,233 T342S probably benign Het
Cib2 A G 9: 54,549,879 F34L probably benign Het
Cnot1 A T 8: 95,733,231 I1836N probably benign Het
Col4a3 C A 1: 82,672,679 P552Q unknown Het
Cp T A 3: 19,989,224 probably benign Het
Cul3 C T 1: 80,290,089 V112I probably benign Het
Dcdc5 A G 2: 106,365,550 noncoding transcript Het
Disp1 A T 1: 183,135,463 V133E probably damaging Het
Dlg4 A G 11: 70,030,925 D30G probably damaging Het
Dopey1 C T 9: 86,492,061 T191I probably damaging Het
Enam T G 5: 88,502,314 S561A probably benign Het
Fbxw8 G T 5: 118,125,027 probably null Het
Filip1 A G 9: 79,817,932 V1135A probably benign Het
Galnt6 T C 15: 100,716,178 T81A probably benign Het
Ghdc T C 11: 100,766,988 K472E probably benign Het
Gm10568 T G 1: 3,680,941 noncoding transcript Het
Gm4788 T G 1: 139,774,563 D61A probably damaging Het
Gm4953 T A 1: 159,168,359 noncoding transcript Het
Gm6871 T A 7: 41,573,592 H24L probably benign Het
Gm8298 T A 3: 59,869,014 probably null Het
Gpr155 G A 2: 73,367,538 Q413* probably null Het
Grhl2 A G 15: 37,291,676 probably null Het
Ighv1-31 G C 12: 114,829,508 S36* probably null Het
Ighv8-5 A G 12: 115,067,842 S26P probably damaging Het
Igkv17-134 A C 6: 67,720,926 probably benign Het
Igkv5-48 A C 6: 69,726,849 L24R probably damaging Het
Isg20l2 T A 3: 87,939,263 V340E probably damaging Het
Lrrtm1 A G 6: 77,244,901 Y447C probably damaging Het
Ltbp1 T C 17: 75,327,292 S855P probably damaging Het
Mgat4e A T 1: 134,541,864 N147K probably damaging Het
Mlc1 A G 15: 88,958,212 L315P possibly damaging Het
Mrgpra2a A G 7: 47,426,544 V322A probably benign Het
Mroh7 T C 4: 106,709,955 probably null Het
Mybpc1 T A 10: 88,555,724 K304* probably null Het
Nlrp14 A C 7: 107,186,583 D622A possibly damaging Het
Nlrp1b T A 11: 71,217,277 H466L probably benign Het
Nlrp4d T A 7: 10,378,409 noncoding transcript Het
Nrxn3 A G 12: 89,260,360 E628G possibly damaging Het
Nup133 T C 8: 123,927,131 R530G possibly damaging Het
Nup98 A G 7: 102,195,800 S21P unknown Het
Olfr1307 A T 2: 111,945,078 I126K possibly damaging Het
Olfr168 T C 16: 19,530,018 T301A probably benign Het
Olfr173 T A 16: 58,797,442 T135S probably benign Het
Olfr251 T A 9: 38,378,742 V287E probably null Het
Olfr671 G A 7: 104,975,479 P169S possibly damaging Het
Olfr753-ps1 T C 17: 37,170,043 I202V probably benign Het
Olfr798 T C 10: 129,625,807 T85A probably damaging Het
Otog A T 7: 46,264,062 Y773F probably damaging Het
Otog A T 7: 46,298,534 I2320F probably damaging Het
Otogl T C 10: 107,879,517 S433G probably benign Het
Pcdhb17 A T 18: 37,485,159 M1L possibly damaging Het
Pde7b T A 10: 20,724,734 probably benign Het
Pgm2 T C 4: 99,963,527 V207A probably damaging Het
Pkd1l1 T A 11: 8,929,360 Y497F possibly damaging Het
Pomgnt2 T C 9: 121,982,947 N256S probably benign Het
Pot1a A T 6: 25,746,021 probably benign Het
Prdm9 T C 17: 15,544,323 T732A probably benign Het
Prg4 T A 1: 150,455,823 probably benign Het
Ptpro T C 6: 137,368,338 V114A probably damaging Het
Pyurf A G 6: 57,691,948 S20P unknown Het
Rasgrf1 A G 9: 89,976,752 T488A probably benign Het
Rassf8 A T 6: 145,815,280 K111* probably null Het
Reps1 A T 10: 18,107,688 E426D probably damaging Het
Robo2 T C 16: 73,933,778 K982R probably damaging Het
Rps23 T C 13: 90,923,752 probably null Het
Scamp4 T A 10: 80,609,671 V56E probably damaging Het
Serpina1c C T 12: 103,895,032 V408I probably benign Het
Sigirr A G 7: 141,093,788 W49R probably damaging Het
Slc17a6 A T 7: 51,658,741 H271L possibly damaging Het
Slc7a5 G T 8: 121,885,122 T389K probably damaging Het
Slf1 T A 13: 77,043,880 H945L probably benign Het
Slit3 T C 11: 35,632,722 S662P probably damaging Het
Snta1 C A 2: 154,377,018 E466* probably null Het
Sowaha A G 11: 53,478,445 L488P probably damaging Het
Spata17 C A 1: 187,194,011 V41F probably damaging Het
Spta1 T A 1: 174,217,863 probably null Het
Srrm2 T A 17: 23,815,388 probably benign Het
Stard13 T C 5: 151,062,527 N388S probably benign Het
Stmn3 T C 2: 181,308,837 K59E probably damaging Het
Sval1 A G 6: 41,955,444 N76S probably benign Het
Svep1 T C 4: 58,096,276 H1448R possibly damaging Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Sytl5 C T X: 9,915,602 P181L possibly damaging Het
Tbkbp1 G A 11: 97,139,130 S400L probably benign Het
Tesc G T 5: 118,056,466 probably benign Het
Tjp1 C T 7: 65,343,727 G33R probably damaging Het
Tlr11 C A 14: 50,362,889 F777L probably benign Het
Tmem156 A G 5: 65,091,462 probably benign Het
Top3a A G 11: 60,752,378 probably benign Het
Tpcn1 A G 5: 120,556,519 W162R probably damaging Het
Tpd52l2 A T 2: 181,515,212 probably benign Het
Trim80 G A 11: 115,446,455 G381D probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn2r117 TC T 17: 23,479,513 probably null Het
Vmn2r56 T A 7: 12,715,535 I259F possibly damaging Het
Vmn2r59 T C 7: 42,043,653 T508A probably benign Het
Wdr73 A G 7: 80,891,708 V362A probably damaging Het
Zdhhc21 G T 4: 82,820,331 T207K possibly damaging Het
Zfp120 T A 2: 150,117,952 Q150L probably damaging Het
Zfp212 C A 6: 47,931,499 Q471K possibly damaging Het
Zfp804b C T 5: 6,770,540 G841D possibly damaging Het
Znfx1 A T 2: 167,036,804 M1884K probably damaging Het
Znfx1 G T 2: 167,037,482 A1658D probably benign Het
Other mutations in Pkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pkd1 APN 17 24580095 missense probably damaging 1.00
IGL00503:Pkd1 APN 17 24565427 missense probably benign
IGL00549:Pkd1 APN 17 24572761 missense probably benign
IGL00573:Pkd1 APN 17 24594530 nonsense probably null
IGL00924:Pkd1 APN 17 24571627 nonsense probably null
IGL01319:Pkd1 APN 17 24587919 unclassified probably benign
IGL01326:Pkd1 APN 17 24576174 nonsense probably null
IGL01457:Pkd1 APN 17 24594821 unclassified probably null
IGL01541:Pkd1 APN 17 24586298 missense probably damaging 1.00
IGL01575:Pkd1 APN 17 24573128 missense probably damaging 1.00
IGL01606:Pkd1 APN 17 24576523 missense probably damaging 0.97
IGL01642:Pkd1 APN 17 24581292 missense probably damaging 1.00
IGL01888:Pkd1 APN 17 24585815 missense possibly damaging 0.91
IGL01940:Pkd1 APN 17 24579746 missense possibly damaging 0.63
IGL01958:Pkd1 APN 17 24580324 missense probably damaging 1.00
IGL02005:Pkd1 APN 17 24586004 missense possibly damaging 0.67
IGL02121:Pkd1 APN 17 24575927 missense probably benign 0.03
IGL02148:Pkd1 APN 17 24579836 missense probably damaging 1.00
IGL02409:Pkd1 APN 17 24573623 missense probably benign 0.01
IGL02442:Pkd1 APN 17 24565226 missense probably benign 0.41
IGL02498:Pkd1 APN 17 24585779 missense possibly damaging 0.91
IGL02501:Pkd1 APN 17 24569699 missense probably benign 0.01
IGL02551:Pkd1 APN 17 24573815 missense probably damaging 1.00
IGL02635:Pkd1 APN 17 24572811 missense probably damaging 1.00
IGL02673:Pkd1 APN 17 24571283 missense probably benign 0.40
IGL02808:Pkd1 APN 17 24593504 missense probably damaging 1.00
IGL02816:Pkd1 APN 17 24594515 missense probably benign 0.00
IGL02863:Pkd1 APN 17 24569752 missense possibly damaging 0.56
IGL02927:Pkd1 APN 17 24575189 missense probably damaging 1.00
IGL02961:Pkd1 APN 17 24578115 missense possibly damaging 0.81
IGL03003:Pkd1 APN 17 24593603 critical splice donor site probably null
IGL03066:Pkd1 APN 17 24586234 missense probably damaging 1.00
IGL03182:Pkd1 APN 17 24573818 missense probably damaging 0.98
IGL03384:Pkd1 APN 17 24565897 missense probably benign 0.00
IGL03404:Pkd1 APN 17 24564406 missense probably damaging 0.97
PIT1430001:Pkd1 UTSW 17 24569511 missense probably damaging 0.99
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0085:Pkd1 UTSW 17 24586223 missense probably damaging 0.98
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0135:Pkd1 UTSW 17 24565071 missense possibly damaging 0.85
R0304:Pkd1 UTSW 17 24585946 missense probably damaging 1.00
R0427:Pkd1 UTSW 17 24593502 missense probably damaging 0.98
R0502:Pkd1 UTSW 17 24574792 missense probably damaging 0.99
R0518:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0521:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0544:Pkd1 UTSW 17 24585683 missense probably damaging 1.00
R0546:Pkd1 UTSW 17 24580138 missense probably benign 0.44
R0626:Pkd1 UTSW 17 24575575 missense probably damaging 0.96
R0648:Pkd1 UTSW 17 24594937 missense probably damaging 1.00
R1138:Pkd1 UTSW 17 24586032 missense probably damaging 1.00
R1302:Pkd1 UTSW 17 24568236 missense probably benign 0.00
R1306:Pkd1 UTSW 17 24573172 missense probably damaging 0.97
R1349:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1372:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1437:Pkd1 UTSW 17 24595132 missense probably damaging 1.00
R1515:Pkd1 UTSW 17 24594853 missense probably benign 0.01
R1605:Pkd1 UTSW 17 24577526 missense possibly damaging 0.95
R1622:Pkd1 UTSW 17 24581640 missense probably benign
R1623:Pkd1 UTSW 17 24578269 missense probably damaging 0.99
R1726:Pkd1 UTSW 17 24564176 missense probably damaging 0.96
R1756:Pkd1 UTSW 17 24594485 missense probably damaging 1.00
R1780:Pkd1 UTSW 17 24581569 missense probably benign
R1785:Pkd1 UTSW 17 24591099 missense probably benign 0.00
R1829:Pkd1 UTSW 17 24565584 missense probably benign
R1869:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
R1920:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1922:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1987:Pkd1 UTSW 17 24576592 splice site probably null
R1988:Pkd1 UTSW 17 24576592 splice site probably null
R1998:Pkd1 UTSW 17 24573014 missense probably damaging 1.00
R2007:Pkd1 UTSW 17 24579785 missense probably damaging 1.00
R2019:Pkd1 UTSW 17 24568684 nonsense probably null
R2054:Pkd1 UTSW 17 24574796 missense probably benign 0.00
R2061:Pkd1 UTSW 17 24569914 missense possibly damaging 0.89
R2196:Pkd1 UTSW 17 24580072 missense possibly damaging 0.60
R2203:Pkd1 UTSW 17 24580889 missense probably benign 0.01
R2301:Pkd1 UTSW 17 24574612 missense probably benign
R2655:Pkd1 UTSW 17 24576490 missense probably damaging 0.99
R2860:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R2861:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R3000:Pkd1 UTSW 17 24594486 missense probably damaging 1.00
R3150:Pkd1 UTSW 17 24579791 missense probably benign 0.00
R3747:Pkd1 UTSW 17 24591461 missense possibly damaging 0.67
R3812:Pkd1 UTSW 17 24565641 missense probably benign 0.00
R3859:Pkd1 UTSW 17 24578092 splice site probably benign
R3893:Pkd1 UTSW 17 24572110 critical splice donor site probably null
R3947:Pkd1 UTSW 17 24578037 splice site probably benign
R3949:Pkd1 UTSW 17 24578037 splice site probably benign
R4176:Pkd1 UTSW 17 24587997 missense probably benign 0.17
R4199:Pkd1 UTSW 17 24570030 missense probably benign 0.41
R4225:Pkd1 UTSW 17 24593523 missense possibly damaging 0.50
R4439:Pkd1 UTSW 17 24585692 missense probably damaging 1.00
R4476:Pkd1 UTSW 17 24576526 missense probably damaging 1.00
R4716:Pkd1 UTSW 17 24576133 missense probably damaging 1.00
R4801:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4802:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4817:Pkd1 UTSW 17 24565374 unclassified probably null
R4903:Pkd1 UTSW 17 24572002 missense probably benign 0.30
R4964:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R4966:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R5040:Pkd1 UTSW 17 24571260 missense probably benign 0.02
R5042:Pkd1 UTSW 17 24569887 missense probably benign 0.00
R5088:Pkd1 UTSW 17 24590838 missense possibly damaging 0.94
R5121:Pkd1 UTSW 17 24573463 missense probably benign
R5296:Pkd1 UTSW 17 24576074 missense probably damaging 1.00
R5338:Pkd1 UTSW 17 24594536 missense probably benign
R5356:Pkd1 UTSW 17 24593577 missense probably damaging 0.97
R5357:Pkd1 UTSW 17 24565790 missense probably damaging 1.00
R5363:Pkd1 UTSW 17 24565073 missense probably benign
R5383:Pkd1 UTSW 17 24574375 missense probably benign
R5622:Pkd1 UTSW 17 24574040 missense possibly damaging 0.67
R5651:Pkd1 UTSW 17 24591387 missense possibly damaging 0.88
R5664:Pkd1 UTSW 17 24569371 missense probably damaging 0.99
R5723:Pkd1 UTSW 17 24565523 missense probably benign 0.01
R5797:Pkd1 UTSW 17 24592641 missense possibly damaging 0.55
R5838:Pkd1 UTSW 17 24580212 missense possibly damaging 0.75
R5866:Pkd1 UTSW 17 24580961 missense probably damaging 0.99
R5873:Pkd1 UTSW 17 24569830 missense probably benign
R5906:Pkd1 UTSW 17 24572920 missense probably benign 0.16
R6047:Pkd1 UTSW 17 24595085 missense probably damaging 1.00
R6076:Pkd1 UTSW 17 24581030 missense probably benign 0.14
R6151:Pkd1 UTSW 17 24575606 missense probably benign 0.00
R6252:Pkd1 UTSW 17 24581226 missense probably damaging 0.98
R6341:Pkd1 UTSW 17 24580227 missense probably damaging 1.00
R6540:Pkd1 UTSW 17 24575977 missense probably damaging 1.00
R6732:Pkd1 UTSW 17 24569413 missense probably damaging 1.00
R6836:Pkd1 UTSW 17 24581259 missense probably damaging 1.00
R6856:Pkd1 UTSW 17 24573493 missense probably benign 0.05
R6865:Pkd1 UTSW 17 24576487 missense probably benign 0.43
X0024:Pkd1 UTSW 17 24591392 missense possibly damaging 0.68
X0061:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
X0065:Pkd1 UTSW 17 24586164 missense probably benign 0.19
Z1088:Pkd1 UTSW 17 24565605 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CAGTTGTGCTTAGAAATGCTCC -3'
(R):5'- TTCTGTAAGCGCCCGTCATG -3'

Sequencing Primer
(F):5'- AGTTGTGCTTAGAAATGCTCCTATCC -3'
(R):5'- TAAGCGCCCGTCATGCTGTAG -3'
Posted On2016-04-15