Incidental Mutation 'R4910:Alpk2'
ID379462
Institutional Source Beutler Lab
Gene Symbol Alpk2
Ensembl Gene ENSMUSG00000032845
Gene Namealpha-kinase 2
SynonymsHak
MMRRC Submission 042512-MU
Accession Numbers

Genbank: NM_001037294

Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R4910 (G1)
Quality Score87
Status Validated
Chromosome18
Chromosomal Location65265529-65393888 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 65266286 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 2074 (K2074*)
Ref Sequence ENSEMBL: ENSMUSP00000048752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035548]
Predicted Effect probably null
Transcript: ENSMUST00000035548
AA Change: K2074*
SMART Domains Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: K2074*

DomainStartEndE-ValueType
IGc2 24 94 9.34e-4 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1337 1353 N/A INTRINSIC
IG 1766 1849 2.27e-2 SMART
Alpha_kinase 1879 2098 3.72e-79 SMART
Meta Mutation Damage Score 0.596 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.6%
  • 20x: 86.1%
Validation Efficiency 95% (144/151)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,998,199 T3016K probably damaging Het
Adam3 T A 8: 24,694,305 I560L probably benign Het
Agxt T C 1: 93,135,714 F113L probably benign Het
Aknad1 T A 3: 108,781,252 probably null Het
Apob A G 12: 8,007,848 Y2077C probably damaging Het
Arhgap17 A T 7: 123,308,377 L254Q probably damaging Het
Arhgap26 T A 18: 38,993,637 probably benign Het
Arhgef5 A G 6: 43,272,828 D171G probably benign Het
Arid1b T A 17: 5,342,203 S2003T probably damaging Het
Armc5 T G 7: 128,240,728 L406R possibly damaging Het
Arsb T C 13: 93,771,977 V67A probably benign Het
Aspm A G 1: 139,491,543 Y2982C probably damaging Het
Btbd7 A G 12: 102,808,048 L487P probably damaging Het
Card11 C G 5: 140,874,414 D1063H probably damaging Het
Ccdc186 G A 19: 56,798,691 T615M probably damaging Het
Cd101 T A 3: 100,993,889 T960S probably benign Het
Cdca7l C A 12: 117,873,785 S191* probably null Het
Cemip A T 7: 83,997,411 I143N probably damaging Het
Cep170 C T 1: 176,782,263 E161K possibly damaging Het
Chrm2 A T 6: 36,524,233 T342S probably benign Het
Cib2 A G 9: 54,549,879 F34L probably benign Het
Cnot1 A T 8: 95,733,231 I1836N probably benign Het
Col4a3 C A 1: 82,672,679 P552Q unknown Het
Cp T A 3: 19,989,224 probably benign Het
Cul3 C T 1: 80,290,089 V112I probably benign Het
Dcdc5 A G 2: 106,365,550 noncoding transcript Het
Disp1 A T 1: 183,135,463 V133E probably damaging Het
Dlg4 A G 11: 70,030,925 D30G probably damaging Het
Dopey1 C T 9: 86,492,061 T191I probably damaging Het
Enam T G 5: 88,502,314 S561A probably benign Het
Fbxw8 G T 5: 118,125,027 probably null Het
Filip1 A G 9: 79,817,932 V1135A probably benign Het
Galnt6 T C 15: 100,716,178 T81A probably benign Het
Ghdc T C 11: 100,766,988 K472E probably benign Het
Gm10568 T G 1: 3,680,941 noncoding transcript Het
Gm4788 T G 1: 139,774,563 D61A probably damaging Het
Gm4953 T A 1: 159,168,359 noncoding transcript Het
Gm6871 T A 7: 41,573,592 H24L probably benign Het
Gm8298 T A 3: 59,869,014 probably null Het
Gpr155 G A 2: 73,367,538 Q413* probably null Het
Grhl2 A G 15: 37,291,676 probably null Het
Ighv1-31 G C 12: 114,829,508 S36* probably null Het
Ighv8-5 A G 12: 115,067,842 S26P probably damaging Het
Igkv17-134 A C 6: 67,720,926 probably benign Het
Igkv5-48 A C 6: 69,726,849 L24R probably damaging Het
Isg20l2 T A 3: 87,939,263 V340E probably damaging Het
Lrrtm1 A G 6: 77,244,901 Y447C probably damaging Het
Ltbp1 T C 17: 75,327,292 S855P probably damaging Het
Mgat4e A T 1: 134,541,864 N147K probably damaging Het
Mlc1 A G 15: 88,958,212 L315P possibly damaging Het
Mrgpra2a A G 7: 47,426,544 V322A probably benign Het
Mroh7 T C 4: 106,709,955 probably null Het
Mybpc1 T A 10: 88,555,724 K304* probably null Het
Nlrp14 A C 7: 107,186,583 D622A possibly damaging Het
Nlrp1b T A 11: 71,217,277 H466L probably benign Het
Nlrp4d T A 7: 10,378,409 noncoding transcript Het
Nrxn3 A G 12: 89,260,360 E628G possibly damaging Het
Nup133 T C 8: 123,927,131 R530G possibly damaging Het
Nup98 A G 7: 102,195,800 S21P unknown Het
Olfr1307 A T 2: 111,945,078 I126K possibly damaging Het
Olfr168 T C 16: 19,530,018 T301A probably benign Het
Olfr173 T A 16: 58,797,442 T135S probably benign Het
Olfr251 T A 9: 38,378,742 V287E probably null Het
Olfr671 G A 7: 104,975,479 P169S possibly damaging Het
Olfr753-ps1 T C 17: 37,170,043 I202V probably benign Het
Olfr798 T C 10: 129,625,807 T85A probably damaging Het
Otog A T 7: 46,264,062 Y773F probably damaging Het
Otog A T 7: 46,298,534 I2320F probably damaging Het
Otogl T C 10: 107,879,517 S433G probably benign Het
Pcdhb17 A T 18: 37,485,159 M1L possibly damaging Het
Pde7b T A 10: 20,724,734 probably benign Het
Pgm2 T C 4: 99,963,527 V207A probably damaging Het
Pkd1 T A 17: 24,572,687 V1116E probably damaging Het
Pkd1l1 T A 11: 8,929,360 Y497F possibly damaging Het
Pomgnt2 T C 9: 121,982,947 N256S probably benign Het
Pot1a A T 6: 25,746,021 probably benign Het
Prdm9 T C 17: 15,544,323 T732A probably benign Het
Prg4 T A 1: 150,455,823 probably benign Het
Ptpro T C 6: 137,368,338 V114A probably damaging Het
Pyurf A G 6: 57,691,948 S20P unknown Het
Rasgrf1 A G 9: 89,976,752 T488A probably benign Het
Rassf8 A T 6: 145,815,280 K111* probably null Het
Reps1 A T 10: 18,107,688 E426D probably damaging Het
Robo2 T C 16: 73,933,778 K982R probably damaging Het
Rps23 T C 13: 90,923,752 probably null Het
Scamp4 T A 10: 80,609,671 V56E probably damaging Het
Serpina1c C T 12: 103,895,032 V408I probably benign Het
Sigirr A G 7: 141,093,788 W49R probably damaging Het
Slc17a6 A T 7: 51,658,741 H271L possibly damaging Het
Slc7a5 G T 8: 121,885,122 T389K probably damaging Het
Slf1 T A 13: 77,043,880 H945L probably benign Het
Slit3 T C 11: 35,632,722 S662P probably damaging Het
Snta1 C A 2: 154,377,018 E466* probably null Het
Sowaha A G 11: 53,478,445 L488P probably damaging Het
Spata17 C A 1: 187,194,011 V41F probably damaging Het
Spta1 T A 1: 174,217,863 probably null Het
Srrm2 T A 17: 23,815,388 probably benign Het
Stard13 T C 5: 151,062,527 N388S probably benign Het
Stmn3 T C 2: 181,308,837 K59E probably damaging Het
Sval1 A G 6: 41,955,444 N76S probably benign Het
Svep1 T C 4: 58,096,276 H1448R possibly damaging Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Sytl5 C T X: 9,915,602 P181L possibly damaging Het
Tbkbp1 G A 11: 97,139,130 S400L probably benign Het
Tesc G T 5: 118,056,466 probably benign Het
Tjp1 C T 7: 65,343,727 G33R probably damaging Het
Tlr11 C A 14: 50,362,889 F777L probably benign Het
Tmem156 A G 5: 65,091,462 probably benign Het
Top3a A G 11: 60,752,378 probably benign Het
Tpcn1 A G 5: 120,556,519 W162R probably damaging Het
Tpd52l2 A T 2: 181,515,212 probably benign Het
Trim80 G A 11: 115,446,455 G381D probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn2r117 TC T 17: 23,479,513 probably null Het
Vmn2r56 T A 7: 12,715,535 I259F possibly damaging Het
Vmn2r59 T C 7: 42,043,653 T508A probably benign Het
Wdr73 A G 7: 80,891,708 V362A probably damaging Het
Zdhhc21 G T 4: 82,820,331 T207K possibly damaging Het
Zfp120 T A 2: 150,117,952 Q150L probably damaging Het
Zfp212 C A 6: 47,931,499 Q471K possibly damaging Het
Zfp804b C T 5: 6,770,540 G841D possibly damaging Het
Znfx1 A T 2: 167,036,804 M1884K probably damaging Het
Znfx1 G T 2: 167,037,482 A1658D probably benign Het
Other mutations in Alpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Alpk2 APN 18 65305823 missense probably benign 0.27
IGL00478:Alpk2 APN 18 65307226 nonsense probably null
IGL00898:Alpk2 APN 18 65350573 missense probably benign 0.29
IGL00978:Alpk2 APN 18 65291534 splice site probably benign
IGL01093:Alpk2 APN 18 65349329 missense probably damaging 0.98
IGL01094:Alpk2 APN 18 65306602 missense probably damaging 0.96
IGL01109:Alpk2 APN 18 65307140 missense probably benign 0.09
IGL01370:Alpk2 APN 18 65350591 missense possibly damaging 0.56
IGL01393:Alpk2 APN 18 65307708 missense possibly damaging 0.88
IGL01629:Alpk2 APN 18 65300042 missense probably damaging 1.00
IGL01872:Alpk2 APN 18 65304753 missense probably benign 0.01
IGL01983:Alpk2 APN 18 65350682 missense probably damaging 1.00
IGL02294:Alpk2 APN 18 65306075 missense possibly damaging 0.45
IGL02333:Alpk2 APN 18 65349480 missense probably damaging 0.99
IGL02493:Alpk2 APN 18 65350331 missense probably benign 0.02
IGL02551:Alpk2 APN 18 65372751 missense probably damaging 1.00
IGL02864:Alpk2 APN 18 65307599 missense probably benign 0.12
IGL02901:Alpk2 APN 18 65306411 missense probably benign
IGL02954:Alpk2 APN 18 65306136 missense probably benign
IGL03257:Alpk2 APN 18 65349874 missense probably damaging 0.99
IGL03389:Alpk2 APN 18 65304866 missense possibly damaging 0.92
3-1:Alpk2 UTSW 18 65304888 missense probably damaging 0.99
PIT4131001:Alpk2 UTSW 18 65306379 missense possibly damaging 0.84
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0414:Alpk2 UTSW 18 65306159 missense probably benign 0.04
R0546:Alpk2 UTSW 18 65306717 missense probably benign 0.05
R0628:Alpk2 UTSW 18 65307296 missense possibly damaging 0.94
R0658:Alpk2 UTSW 18 65349487 missense probably damaging 1.00
R0731:Alpk2 UTSW 18 65305390 missense probably damaging 0.98
R0919:Alpk2 UTSW 18 65307473 missense probably benign
R1069:Alpk2 UTSW 18 65305014 missense probably benign 0.25
R1186:Alpk2 UTSW 18 65294341 critical splice acceptor site probably null
R1508:Alpk2 UTSW 18 65349305 missense probably damaging 1.00
R1535:Alpk2 UTSW 18 65350204 missense probably benign
R1558:Alpk2 UTSW 18 65350230 missense probably benign
R1600:Alpk2 UTSW 18 65378037 missense probably damaging 0.96
R1664:Alpk2 UTSW 18 65349873 missense probably damaging 0.96
R1672:Alpk2 UTSW 18 65280959 missense probably damaging 1.00
R1829:Alpk2 UTSW 18 65294094 missense possibly damaging 0.75
R2110:Alpk2 UTSW 18 65307080 missense possibly damaging 0.94
R2111:Alpk2 UTSW 18 65349774 missense probably benign
R2113:Alpk2 UTSW 18 65305683 missense probably benign 0.31
R2126:Alpk2 UTSW 18 65350368 nonsense probably null
R2198:Alpk2 UTSW 18 65350184 missense probably benign 0.42
R2227:Alpk2 UTSW 18 65378076 missense probably damaging 1.00
R2245:Alpk2 UTSW 18 65305163 missense probably benign 0.02
R2282:Alpk2 UTSW 18 65307626 missense probably benign
R2421:Alpk2 UTSW 18 65306616 missense probably benign 0.00
R2512:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R3105:Alpk2 UTSW 18 65350210 missense possibly damaging 0.57
R3700:Alpk2 UTSW 18 65305151 missense probably damaging 0.99
R4205:Alpk2 UTSW 18 65305211 missense possibly damaging 0.76
R4239:Alpk2 UTSW 18 65300141 missense probably damaging 1.00
R4353:Alpk2 UTSW 18 65291452 missense possibly damaging 0.73
R4572:Alpk2 UTSW 18 65281004 missense probably damaging 1.00
R4584:Alpk2 UTSW 18 65306964 missense probably damaging 0.99
R4591:Alpk2 UTSW 18 65305823 missense probably benign 0.27
R4595:Alpk2 UTSW 18 65289748 missense probably damaging 1.00
R4648:Alpk2 UTSW 18 65349882 missense probably damaging 0.99
R4815:Alpk2 UTSW 18 65349955 missense probably damaging 1.00
R4828:Alpk2 UTSW 18 65349113 missense probably benign
R5042:Alpk2 UTSW 18 65350508 nonsense probably null
R5295:Alpk2 UTSW 18 65305038 missense probably damaging 0.98
R5375:Alpk2 UTSW 18 65372738 missense probably damaging 1.00
R5475:Alpk2 UTSW 18 65307012 missense probably benign 0.16
R5480:Alpk2 UTSW 18 65349908 missense probably damaging 1.00
R5486:Alpk2 UTSW 18 65294354 splice site probably null
R5503:Alpk2 UTSW 18 65306241 missense probably benign 0.00
R5595:Alpk2 UTSW 18 65266248 missense probably damaging 1.00
R5648:Alpk2 UTSW 18 65349917 missense probably damaging 0.96
R5714:Alpk2 UTSW 18 65305461 missense possibly damaging 0.55
R5862:Alpk2 UTSW 18 65307289 missense probably damaging 1.00
R5894:Alpk2 UTSW 18 65281072 missense probably damaging 0.99
R5898:Alpk2 UTSW 18 65307623 missense probably damaging 0.99
R5936:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R6142:Alpk2 UTSW 18 65305385 missense possibly damaging 0.94
R6291:Alpk2 UTSW 18 65305901 missense possibly damaging 0.93
R6339:Alpk2 UTSW 18 65349806 missense probably benign 0.00
R6407:Alpk2 UTSW 18 65289738 missense probably benign 0.22
R6487:Alpk2 UTSW 18 65266183 missense possibly damaging 0.62
R6667:Alpk2 UTSW 18 65307740 missense probably damaging 1.00
R6786:Alpk2 UTSW 18 65306634 missense probably benign
R6833:Alpk2 UTSW 18 65306409 missense probably benign 0.08
R6984:Alpk2 UTSW 18 65305678 missense possibly damaging 0.95
X0023:Alpk2 UTSW 18 65291400 missense probably damaging 1.00
X0027:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
X0063:Alpk2 UTSW 18 65307363 missense probably benign
X0064:Alpk2 UTSW 18 65349684 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCAGACTCAGGCGTCTTCAC -3'
(R):5'- TGCACTGTGTTTGCCTATGAC -3'

Sequencing Primer
(F):5'- CACCTGCGTGGCGTTTGTC -3'
(R):5'- GTGTTTGCCTATGACTCTTCG -3'
Posted On2016-04-15