Incidental Mutation 'R4911:Myo1e'
ID379546
Institutional Source Beutler Lab
Gene Symbol Myo1e
Ensembl Gene ENSMUSG00000032220
Gene Namemyosin IE
Synonyms2310020N23Rik, 9130023P14Rik
MMRRC Submission 042513-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4911 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70207350-70399766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70343096 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 528 (M528K)
Ref Sequence ENSEMBL: ENSMUSP00000034745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]
PDB Structure
MYOSIN 1E SH3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034745
AA Change: M528K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: M528K

DomainStartEndE-ValueType
MYSc 13 693 N/A SMART
Pfam:Myosin_TH1 719 917 1e-55 PFAM
SH3 1053 1107 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214767
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (149/153)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 132 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,170,939 probably null Het
4430402I18Rik G A 19: 28,897,503 probably benign Het
Aacs A G 5: 125,506,160 D260G possibly damaging Het
Aadacl4 T A 4: 144,613,792 L29H probably damaging Het
Abca7 T C 10: 80,012,188 probably null Het
Adgre1 G A 17: 57,447,832 M643I possibly damaging Het
Adgrl2 A T 3: 148,890,463 M79K probably damaging Het
Ankrd55 T A 13: 112,323,039 probably null Het
Arhgap21 A G 2: 20,858,989 I1257T probably damaging Het
Arhgap26 T A 18: 38,993,637 probably benign Het
Arhgap39 A G 15: 76,737,805 S199P probably damaging Het
Arhgef5 A G 6: 43,272,828 D171G probably benign Het
Atp7a T C X: 106,120,374 V1305A probably damaging Het
B3gnt3 T A 8: 71,692,934 R263S probably benign Het
B9d1 A C 11: 61,507,671 D59A probably benign Het
Bag2 A T 1: 33,748,276 I55N probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bbs2 A T 8: 94,089,115 D174E probably damaging Het
Bmp8b T C 4: 123,115,237 W203R probably damaging Het
Cacnb2 A T 2: 14,981,340 E359D possibly damaging Het
Camp T A 9: 109,847,583 probably null Het
Casp4 C T 9: 5,328,580 probably benign Het
Ccdc110 A T 8: 45,942,907 T612S probably benign Het
Cd209b T A 8: 3,926,640 probably null Het
Cemip T C 7: 83,983,253 D367G probably damaging Het
Cers5 T A 15: 99,747,079 N131I probably damaging Het
Chd5 T G 4: 152,360,672 V370G probably damaging Het
Cipc C A 12: 86,952,757 Q20K probably benign Het
Cnr2 T A 4: 135,917,201 F197I possibly damaging Het
Col7a1 G A 9: 108,975,219 G2233S unknown Het
Dcdc2b T A 4: 129,611,267 I125F possibly damaging Het
Ddi2 A G 4: 141,684,402 S400P probably benign Het
Ddx31 C A 2: 28,904,684 T664K probably benign Het
Dhx30 C A 9: 110,100,924 G35C probably damaging Het
Dmxl2 G A 9: 54,411,653 T1576I probably damaging Het
Dnah1 T C 14: 31,295,323 Y1510C probably damaging Het
Dnah2 C T 11: 69,499,104 probably null Het
Dock10 C A 1: 80,606,236 G163C probably damaging Het
Edar T C 10: 58,621,324 N144S probably benign Het
Elavl2 T A 4: 91,308,678 E54D possibly damaging Het
Enam T G 5: 88,502,314 S561A probably benign Het
Ercc5 C A 1: 44,166,871 H315N possibly damaging Het
Esp31 A G 17: 38,644,661 E65G possibly damaging Het
Faap100 T C 11: 120,372,113 I806M probably benign Het
Fam159a T C 4: 108,377,461 T70A probably benign Het
Fbxw21 T C 9: 109,145,663 Y263C probably damaging Het
Fsip2 T A 2: 82,981,493 S2719T possibly damaging Het
Fv1 T C 4: 147,869,418 V147A probably benign Het
Gal T C 19: 3,411,590 E65G probably benign Het
Galnt6 T C 15: 100,716,178 T81A probably benign Het
Gcc2 A G 10: 58,270,439 E399G probably damaging Het
Gfi1b A T 2: 28,610,102 C306S probably damaging Het
Gm10654 T A 8: 70,931,852 noncoding transcript Het
Gm20388 A G 8: 123,080,604 probably benign Het
Gm4788 T G 1: 139,774,563 D61A probably damaging Het
Gm4953 T A 1: 159,168,359 noncoding transcript Het
Gorasp2 T C 2: 70,688,339 probably benign Het
Gse1 T C 8: 120,568,466 probably benign Het
H2-D1 A G 17: 35,265,997 E278G probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hgs T A 11: 120,477,202 S246T probably damaging Het
Hs2st1 T C 3: 144,465,082 T110A probably benign Het
Hydin A G 8: 110,595,438 Y4574C probably benign Het
Ighv1-23 C A 12: 114,764,752 V17F possibly damaging Het
Ighv8-14 A T 12: 115,808,565 noncoding transcript Het
Igsf21 C T 4: 140,034,623 R248H probably benign Het
Il23r T C 6: 67,423,561 N595S probably benign Het
Il5ra G T 6: 106,715,668 P372Q probably damaging Het
Iltifb T C 10: 118,294,989 M1V probably null Het
Inppl1 A G 7: 101,832,309 V222A possibly damaging Het
Ints10 T C 8: 68,827,312 V697A probably damaging Het
Isg15 T A 4: 156,199,760 T104S probably benign Het
Kif11 A G 19: 37,417,937 T983A probably benign Het
Kif3b A T 2: 153,317,292 K338* probably null Het
Kpna2 T A 11: 106,990,719 I362F probably damaging Het
Lama2 G A 10: 27,138,927 T1595M probably damaging Het
Lrrc36 A G 8: 105,426,935 T126A probably benign Het
Lrrk1 T A 7: 66,295,454 D604V probably damaging Het
Map7d1 T C 4: 126,236,691 K409E probably damaging Het
Mast2 T C 4: 116,353,057 T110A probably benign Het
Micall2 G A 5: 139,716,825 T221M probably damaging Het
Morc2b T A 17: 33,137,377 N474Y probably damaging Het
Nlrp1c-ps G T 11: 71,260,369 noncoding transcript Het
Nostrin T C 2: 69,161,142 S160P possibly damaging Het
Nup133 T C 8: 123,927,131 R530G possibly damaging Het
Olfr452 T A 6: 42,790,204 L55H probably damaging Het
Olfr488 T C 7: 108,256,037 I34V possibly damaging Het
Olfr894 A G 9: 38,219,096 E91G probably damaging Het
Pabpc4l A T 3: 46,446,162 M349K possibly damaging Het
Pah G A 10: 87,570,267 G256S probably benign Het
Park2 G T 17: 10,840,472 probably benign Het
Pigk T C 3: 152,740,204 S151P probably damaging Het
Plcd4 A C 1: 74,564,413 T658P possibly damaging Het
Pld4 A T 12: 112,764,517 S178C probably benign Het
Polr1a G A 6: 71,909,229 E23K possibly damaging Het
Pomt1 T C 2: 32,241,679 S127P probably damaging Het
Pon2 A G 6: 5,269,029 V215A possibly damaging Het
Ppp3cb A T 14: 20,509,440 M416K probably damaging Het
Prdm1 A T 10: 44,442,052 N273K possibly damaging Het
Prg4 T A 1: 150,455,823 probably benign Het
Ptch1 G A 13: 63,523,052 T888M probably damaging Het
Pusl1 T G 4: 155,891,442 probably benign Het
Rapgef6 A T 11: 54,622,317 E122D probably damaging Het
Rif1 C T 2: 52,110,518 T1328I probably damaging Het
Rngtt T G 4: 33,500,292 probably null Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Samd1 A G 8: 83,998,989 probably benign Het
Scamp5 A T 9: 57,451,452 F14I probably damaging Het
Shank3 C T 15: 89,504,344 R380C probably damaging Het
Slc1a4 C A 11: 20,332,166 A103S probably damaging Het
Slc39a14 A G 14: 70,309,922 V325A probably benign Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Sval1 A G 6: 41,955,444 N76S probably benign Het
Synpo C T 18: 60,629,864 probably benign Het
Sytl5 C T X: 9,915,602 P181L possibly damaging Het
Tacc1 A G 8: 25,182,606 M111T possibly damaging Het
Tec T C 5: 72,756,351 D613G probably benign Het
Tecpr2 C T 12: 110,931,487 T391I possibly damaging Het
Thop1 G A 10: 81,073,291 G52D probably damaging Het
Tmco5 T A 2: 116,892,208 V270D possibly damaging Het
Ttn C T 2: 76,726,629 E28265K possibly damaging Het
Tuft1 T C 3: 94,635,443 D72G probably damaging Het
Tyrp1 C T 4: 80,850,907 probably benign Het
Usp9y T C Y: 1,308,041 D2265G probably damaging Het
Vmn2r104 G A 17: 20,030,026 A661V probably benign Het
Vwa5a A T 9: 38,737,972 N672I probably benign Het
Wdr95 A T 5: 149,611,692 K772* probably null Het
Ybx1 T C 4: 119,282,813 T106A probably benign Het
Ypel3 T C 7: 126,777,789 S14P probably benign Het
Zfp518a T A 19: 40,915,528 S1300R probably benign Het
Zscan5b A T 7: 6,239,190 *469Y probably null Het
Other mutations in Myo1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Myo1e APN 9 70342148 missense probably benign 0.01
IGL00833:Myo1e APN 9 70338778 missense probably damaging 0.99
IGL00973:Myo1e APN 9 70338787 missense probably damaging 1.00
IGL01011:Myo1e APN 9 70316589 splice site probably benign
IGL01401:Myo1e APN 9 70327166 missense probably damaging 0.97
IGL01402:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01404:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01613:Myo1e APN 9 70341273 splice site probably benign
IGL01738:Myo1e APN 9 70359370 missense probably damaging 1.00
IGL01819:Myo1e APN 9 70343040 splice site probably benign
IGL02233:Myo1e APN 9 70383799 splice site probably benign
IGL02244:Myo1e APN 9 70367689 missense probably benign 0.00
IGL02440:Myo1e APN 9 70346740 missense probably damaging 1.00
IGL02806:Myo1e APN 9 70362270 missense probably benign 0.01
IGL02886:Myo1e APN 9 70368773 missense probably benign 0.00
IGL03178:Myo1e APN 9 70286949 missense possibly damaging 0.47
I2288:Myo1e UTSW 9 70342097 missense possibly damaging 0.80
R0036:Myo1e UTSW 9 70341308 missense probably damaging 1.00
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0399:Myo1e UTSW 9 70301793 splice site probably benign
R0526:Myo1e UTSW 9 70322398 missense probably damaging 1.00
R0599:Myo1e UTSW 9 70376660 splice site probably benign
R0656:Myo1e UTSW 9 70367674 missense probably damaging 1.00
R1078:Myo1e UTSW 9 70383999 missense probably benign
R1278:Myo1e UTSW 9 70398785 missense probably damaging 1.00
R1300:Myo1e UTSW 9 70301783 missense probably damaging 1.00
R1329:Myo1e UTSW 9 70338738 missense possibly damaging 0.96
R1349:Myo1e UTSW 9 70287069 splice site probably benign
R1463:Myo1e UTSW 9 70338756 missense possibly damaging 0.88
R1656:Myo1e UTSW 9 70395934 missense probably damaging 1.00
R1727:Myo1e UTSW 9 70376524 missense possibly damaging 0.88
R1789:Myo1e UTSW 9 70338784 missense probably damaging 1.00
R1970:Myo1e UTSW 9 70368773 missense probably benign 0.00
R2029:Myo1e UTSW 9 70368687 missense possibly damaging 0.78
R2029:Myo1e UTSW 9 70378715 splice site probably benign
R2039:Myo1e UTSW 9 70320133 missense possibly damaging 0.89
R2076:Myo1e UTSW 9 70383877 missense probably benign
R2256:Myo1e UTSW 9 70378373 splice site probably null
R2257:Myo1e UTSW 9 70378373 splice site probably null
R2323:Myo1e UTSW 9 70378758 nonsense probably null
R2443:Myo1e UTSW 9 70327172 missense probably benign
R4023:Myo1e UTSW 9 70324875 missense probably benign
R4024:Myo1e UTSW 9 70324875 missense probably benign
R4025:Myo1e UTSW 9 70324875 missense probably benign
R4026:Myo1e UTSW 9 70324875 missense probably benign
R4151:Myo1e UTSW 9 70297351 nonsense probably null
R4764:Myo1e UTSW 9 70343135 splice site probably null
R4768:Myo1e UTSW 9 70370469 missense possibly damaging 0.63
R4995:Myo1e UTSW 9 70353272 missense probably benign 0.01
R4999:Myo1e UTSW 9 70353312 missense probably damaging 1.00
R5228:Myo1e UTSW 9 70322358 intron probably null
R5414:Myo1e UTSW 9 70322358 intron probably null
R5577:Myo1e UTSW 9 70370471 missense probably benign 0.31
R5851:Myo1e UTSW 9 70383804 missense probably benign 0.17
R6208:Myo1e UTSW 9 70376605 missense probably damaging 0.99
R6907:Myo1e UTSW 9 70327155 missense probably benign
R7084:Myo1e UTSW 9 70337801 missense probably damaging 0.96
R7313:Myo1e UTSW 9 70359385 critical splice donor site probably null
R7383:Myo1e UTSW 9 70297295 missense probably damaging 1.00
X0021:Myo1e UTSW 9 70378273 missense probably damaging 0.99
X0065:Myo1e UTSW 9 70378294 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGCACCTCAAAGGCAATAGC -3'
(R):5'- GTTGAAACAACACCATCACTGG -3'

Sequencing Primer
(F):5'- TAGCCAGAAACATTCACCTTCTCATG -3'
(R):5'- TCTAGAGGACCTGGGTTCAACTC -3'
Posted On2016-04-15