Incidental Mutation 'R4912:Dffb'
ID379611
Institutional Source Beutler Lab
Gene Symbol Dffb
Ensembl Gene ENSMUSG00000029027
Gene NameDNA fragmentation factor, beta subunit
Synonyms5730477D02Rik, caspase-activated DNase, Didff, CAD, CPAN, DFF40, 40kDa
MMRRC Submission 042514-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4912 (G1)
Quality Score209
Status Not validated
Chromosome4
Chromosomal Location153964449-153975126 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 153965407 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030893] [ENSMUST00000058393] [ENSMUST00000105645] [ENSMUST00000133607] [ENSMUST00000141493] [ENSMUST00000147826]
Predicted Effect unknown
Transcript: ENSMUST00000030893
AA Change: Q333L
SMART Domains Protein: ENSMUSP00000030893
Gene: ENSMUSG00000029027
AA Change: Q333L

DomainStartEndE-ValueType
CAD 9 81 2.48e-41 SMART
Pfam:DFF40 103 324 9.4e-97 PFAM
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058393
SMART Domains Protein: ENSMUSP00000054638
Gene: ENSMUSG00000047613

DomainStartEndE-ValueType
Pfam:UPF0688 6 228 9.9e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133524
Predicted Effect probably benign
Transcript: ENSMUST00000133607
Predicted Effect probably benign
Transcript: ENSMUST00000141493
Predicted Effect probably benign
Transcript: ENSMUST00000147826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219093
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some of these variants has not been determined. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and developmentally normal; however, mutant thymocytes and other cell types fail to undergo apoptotic DNA fragmentation in response to dexamethasone or other apoptotic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,419,856 D52G possibly damaging Het
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
Acaa1a C A 9: 119,342,761 R102S probably damaging Het
Arhgef12 G A 9: 42,993,065 R706* probably null Het
Best3 A G 10: 117,008,981 Y347C probably damaging Het
Birc6 T A 17: 74,565,905 D386E probably damaging Het
C130050O18Rik A T 5: 139,414,389 T66S probably benign Het
Chd9 A T 8: 91,034,230 D2201V possibly damaging Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Diaph3 A C 14: 87,007,199 C217W probably damaging Het
Eml2 T A 7: 19,193,999 probably null Het
Ercc5 T C 1: 44,157,057 I70T probably damaging Het
Fryl AGTGTGT AGTGT 5: 73,068,782 probably null Het
Fsd1 C T 17: 55,991,241 P189S possibly damaging Het
Gm42669 A G 5: 107,508,817 K982R probably damaging Het
Gm5414 A G 15: 101,625,010 I373T possibly damaging Het
Gm7356 A G 17: 14,001,236 L177P possibly damaging Het
Grip1 G A 10: 119,931,248 D93N probably damaging Het
Hbq1b T A 11: 32,287,014 M1K probably null Het
Hps3 C A 3: 20,014,173 L572F probably damaging Het
Ighj2 T A 12: 113,429,480 probably benign Het
Kcna3 T C 3: 107,037,891 M490T probably benign Het
Krt76 T A 15: 101,888,162 K404* probably null Het
Lgr4 A T 2: 110,006,502 probably null Het
Ltbp4 G T 7: 27,306,116 C1533* probably null Het
Mapre2 A G 18: 23,832,933 N25S probably damaging Het
Mark3 T A 12: 111,592,653 I43K probably benign Het
Mon1b T A 8: 113,641,953 Y495* probably null Het
Mrfap1 A G 5: 36,796,745 probably benign Het
Mxra8 A G 4: 155,840,904 probably null Het
Myoz1 A T 14: 20,649,538 L244Q probably damaging Het
Ndfip2 C T 14: 105,258,685 R5W probably benign Het
Nek11 T C 9: 105,287,658 D423G probably benign Het
Nin A T 12: 70,044,063 D859E probably damaging Het
Nup210 G A 6: 91,017,529 A1729V probably benign Het
Olfm3 A G 3: 115,101,940 E157G probably damaging Het
Olfr397 A T 11: 73,965,340 H244L probably damaging Het
Prickle1 A G 15: 93,500,548 S800P probably benign Het
Reln A G 5: 21,925,193 S2707P probably benign Het
Rexo4 G A 2: 26,962,392 T200M possibly damaging Het
Saxo2 T A 7: 82,634,535 I372L probably benign Het
Scgb2b2 T A 7: 31,303,631 D50E probably benign Het
Sipa1l1 T C 12: 82,396,678 L914P possibly damaging Het
Slf1 T A 13: 77,051,294 D656V probably damaging Het
Sorbs1 T C 19: 40,311,727 D1192G probably damaging Het
Tdrd6 A C 17: 43,624,327 D1943E probably benign Het
Tmem163 G A 1: 127,491,625 T281M probably damaging Het
Tmod3 A G 9: 75,532,448 V35A probably damaging Het
Ttc39c A T 18: 12,734,894 Q448L probably benign Het
Ulk1 A T 5: 110,787,589 S937T probably damaging Het
Unc13c T A 9: 73,574,022 D1711V probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Utp20 G T 10: 88,771,960 Q1596K probably benign Het
Vmn1r28 A T 6: 58,265,540 I123F possibly damaging Het
Vmn1r73 T A 7: 11,756,669 V138E probably damaging Het
Vmn2r112 A G 17: 22,603,382 D347G probably damaging Het
Vmn2r3 T G 3: 64,259,197 T838P probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wdr17 T C 8: 54,629,861 D1268G probably damaging Het
Zfp108 T A 7: 24,261,314 H443Q probably damaging Het
Zfp608 A G 18: 54,946,591 V374A probably damaging Het
Zfp831 G T 2: 174,644,624 G364V probably damaging Het
Zfp94 A G 7: 24,303,741 V86A probably benign Het
Zkscan16 A C 4: 58,946,506 N127T possibly damaging Het
Other mutations in Dffb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Dffb APN 4 153965616 unclassified probably benign
R0243:Dffb UTSW 4 153965378 nonsense probably null
R0244:Dffb UTSW 4 153974615 missense probably benign 0.33
R2483:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3622:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3623:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3624:Dffb UTSW 4 153965519 missense probably damaging 1.00
R4562:Dffb UTSW 4 153965456 missense probably damaging 1.00
R5015:Dffb UTSW 4 153972959 missense possibly damaging 0.84
R5986:Dffb UTSW 4 153965593 missense probably damaging 1.00
R6950:Dffb UTSW 4 153970092 missense probably benign
R7395:Dffb UTSW 4 153969113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCGTATAGTCAGAGCTGC -3'
(R):5'- GTGGCACTCACAGTAGAATGG -3'

Sequencing Primer
(F):5'- ATAGTCAGAGCTGCCATTTGC -3'
(R):5'- TCCCCCTGACTTGGTAGAATAGAG -3'
Posted On2016-04-15