Incidental Mutation 'R4912:2810474O19Rik'
List |< first << previous [record 13 of 1871] next >> last >|
ID379625
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
MMRRC Submission 042514-MU
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4912 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 149329389 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1311 (S1311C)
Ref Sequence ENSEMBL: ENSMUSP00000140026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
Predicted Effect probably damaging
Transcript: ENSMUST00000046689
AA Change: S1311C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: S1311C

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100765
AA Change: S1311C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: S1311C

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect probably benign
Transcript: ENSMUST00000130664
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect probably damaging
Transcript: ENSMUST00000189837
AA Change: S1311C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: S1311C

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189932
AA Change: S1311C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: S1311C

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190785
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,419,856 D52G possibly damaging Het
Acaa1a C A 9: 119,342,761 R102S probably damaging Het
Arhgef12 G A 9: 42,993,065 R706* probably null Het
Best3 A G 10: 117,008,981 Y347C probably damaging Het
Birc6 T A 17: 74,565,905 D386E probably damaging Het
C130050O18Rik A T 5: 139,414,389 T66S probably benign Het
Chd9 A T 8: 91,034,230 D2201V possibly damaging Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Dffb T A 4: 153,965,407 probably benign Het
Diaph3 A C 14: 87,007,199 C217W probably damaging Het
Eml2 T A 7: 19,193,999 probably null Het
Ercc5 T C 1: 44,157,057 I70T probably damaging Het
Fryl AGTGTGT AGTGT 5: 73,068,782 probably null Het
Fsd1 C T 17: 55,991,241 P189S possibly damaging Het
Gm42669 A G 5: 107,508,817 K982R probably damaging Het
Gm5414 A G 15: 101,625,010 I373T possibly damaging Het
Gm7356 A G 17: 14,001,236 L177P possibly damaging Het
Grip1 G A 10: 119,931,248 D93N probably damaging Het
Hbq1b T A 11: 32,287,014 M1K probably null Het
Hps3 C A 3: 20,014,173 L572F probably damaging Het
Ighj2 T A 12: 113,429,480 probably benign Het
Kcna3 T C 3: 107,037,891 M490T probably benign Het
Krt76 T A 15: 101,888,162 K404* probably null Het
Lgr4 A T 2: 110,006,502 probably null Het
Ltbp4 G T 7: 27,306,116 C1533* probably null Het
Mapre2 A G 18: 23,832,933 N25S probably damaging Het
Mark3 T A 12: 111,592,653 I43K probably benign Het
Mon1b T A 8: 113,641,953 Y495* probably null Het
Mrfap1 A G 5: 36,796,745 probably benign Het
Mxra8 A G 4: 155,840,904 probably null Het
Myoz1 A T 14: 20,649,538 L244Q probably damaging Het
Ndfip2 C T 14: 105,258,685 R5W probably benign Het
Nek11 T C 9: 105,287,658 D423G probably benign Het
Nin A T 12: 70,044,063 D859E probably damaging Het
Nup210 G A 6: 91,017,529 A1729V probably benign Het
Olfm3 A G 3: 115,101,940 E157G probably damaging Het
Olfr397 A T 11: 73,965,340 H244L probably damaging Het
Prickle1 A G 15: 93,500,548 S800P probably benign Het
Reln A G 5: 21,925,193 S2707P probably benign Het
Rexo4 G A 2: 26,962,392 T200M possibly damaging Het
Saxo2 T A 7: 82,634,535 I372L probably benign Het
Scgb2b2 T A 7: 31,303,631 D50E probably benign Het
Sipa1l1 T C 12: 82,396,678 L914P possibly damaging Het
Slf1 T A 13: 77,051,294 D656V probably damaging Het
Sorbs1 T C 19: 40,311,727 D1192G probably damaging Het
Tdrd6 A C 17: 43,624,327 D1943E probably benign Het
Tmem163 G A 1: 127,491,625 T281M probably damaging Het
Tmod3 A G 9: 75,532,448 V35A probably damaging Het
Ttc39c A T 18: 12,734,894 Q448L probably benign Het
Ulk1 A T 5: 110,787,589 S937T probably damaging Het
Unc13c T A 9: 73,574,022 D1711V probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Utp20 G T 10: 88,771,960 Q1596K probably benign Het
Vmn1r28 A T 6: 58,265,540 I123F possibly damaging Het
Vmn1r73 T A 7: 11,756,669 V138E probably damaging Het
Vmn2r112 A G 17: 22,603,382 D347G probably damaging Het
Vmn2r3 T G 3: 64,259,197 T838P probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wdr17 T C 8: 54,629,861 D1268G probably damaging Het
Zfp108 T A 7: 24,261,314 H443Q probably damaging Het
Zfp608 A G 18: 54,946,591 V374A probably damaging Het
Zfp831 G T 2: 174,644,624 G364V probably damaging Het
Zfp94 A G 7: 24,303,741 V86A probably benign Het
Zkscan16 A C 4: 58,946,506 N127T possibly damaging Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably damaging 0.97
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGGAATATTTACAACGGCAG -3'
(R):5'- TGTGCATTTAAACGCAACTCG -3'

Sequencing Primer
(F):5'- GCTTCCAGAAACATCTGTGTAG -3'
(R):5'- CGCAACTCGATTCAAGTACTG -3'
Posted On2016-04-15