Incidental Mutation 'R4913:Tle3'
ID379710
Institutional Source Beutler Lab
Gene Symbol Tle3
Ensembl Gene ENSMUSG00000032280
Gene Nametransducin-like enhancer of split 3
Synonyms2610103N05Rik, ESG, Grg3a, Grg3b
MMRRC Submission 042515-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4913 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location61372366-61418497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61373993 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 22 (V22E)
Ref Sequence ENSEMBL: ENSMUSP00000124055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034820] [ENSMUST00000159050] [ENSMUST00000159386] [ENSMUST00000159630] [ENSMUST00000160541] [ENSMUST00000160724] [ENSMUST00000160882] [ENSMUST00000161194] [ENSMUST00000161207] [ENSMUST00000161689] [ENSMUST00000161993] [ENSMUST00000162127] [ENSMUST00000162583] [ENSMUST00000162973] [ENSMUST00000178113]
Predicted Effect probably damaging
Transcript: ENSMUST00000034820
AA Change: V22E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034820
Gene: ENSMUSG00000032280
AA Change: V22E

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 4.3e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 468 505 2.96e-2 SMART
WD40 511 552 4.48e-2 SMART
WD40 557 596 2.84e-4 SMART
WD40 599 638 7.55e-9 SMART
WD40 641 679 3.07e1 SMART
WD40 681 720 4.18e-2 SMART
WD40 721 761 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098658
SMART Domains Protein: ENSMUSP00000096255
Gene: ENSMUSG00000074256

DomainStartEndE-ValueType
low complexity region 50 59 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 115 125 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159050
AA Change: V22E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125032
Gene: ENSMUSG00000032280
AA Change: V22E

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.1e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 471 508 2.96e-2 SMART
WD40 514 555 4.48e-2 SMART
WD40 560 599 2.84e-4 SMART
WD40 602 641 7.55e-9 SMART
WD40 644 682 3.07e1 SMART
WD40 684 723 4.18e-2 SMART
WD40 724 764 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159386
AA Change: V22E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125049
Gene: ENSMUSG00000032280
AA Change: V22E

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.1e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 464 501 2.96e-2 SMART
WD40 507 548 4.48e-2 SMART
WD40 553 592 2.84e-4 SMART
WD40 595 634 7.55e-9 SMART
WD40 637 675 3.07e1 SMART
WD40 677 716 4.18e-2 SMART
WD40 717 757 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159630
SMART Domains Protein: ENSMUSP00000123723
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 79 1.7e-43 PFAM
low complexity region 104 122 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
low complexity region 226 245 N/A INTRINSIC
WD40 416 453 2.96e-2 SMART
WD40 459 500 4.48e-2 SMART
WD40 505 544 2.84e-4 SMART
WD40 547 586 7.55e-9 SMART
WD40 589 627 3.07e1 SMART
WD40 629 668 4.18e-2 SMART
WD40 669 709 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160541
SMART Domains Protein: ENSMUSP00000124158
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 80 3.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160724
AA Change: V22E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124055
Gene: ENSMUSG00000032280
AA Change: V22E

DomainStartEndE-ValueType
Pfam:TLE_N 1 145 1.9e-77 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 204 216 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160882
AA Change: V22E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124131
Gene: ENSMUSG00000032280
AA Change: V22E

DomainStartEndE-ValueType
Pfam:TLE_N 1 146 4.8e-76 PFAM
low complexity region 171 189 N/A INTRINSIC
low complexity region 205 217 N/A INTRINSIC
low complexity region 293 312 N/A INTRINSIC
WD40 486 523 2.96e-2 SMART
WD40 529 570 4.48e-2 SMART
WD40 575 614 2.84e-4 SMART
WD40 617 656 7.55e-9 SMART
WD40 659 697 3.07e1 SMART
WD40 699 738 4.18e-2 SMART
WD40 739 779 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161194
SMART Domains Protein: ENSMUSP00000125537
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 53 7.3e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161207
AA Change: V15E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124557
Gene: ENSMUSG00000032280
AA Change: V15E

DomainStartEndE-ValueType
Pfam:TLE_N 1 129 1e-73 PFAM
low complexity region 154 172 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
WD40 466 503 2.96e-2 SMART
WD40 509 550 4.48e-2 SMART
WD40 555 594 2.84e-4 SMART
WD40 597 636 7.55e-9 SMART
WD40 639 677 3.07e1 SMART
WD40 679 718 4.18e-2 SMART
WD40 719 759 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161689
SMART Domains Protein: ENSMUSP00000125011
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 80 4.8e-44 PFAM
low complexity region 105 123 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 227 246 N/A INTRINSIC
WD40 420 457 2.96e-2 SMART
WD40 463 504 4.48e-2 SMART
WD40 509 548 2.84e-4 SMART
WD40 551 590 7.55e-9 SMART
WD40 593 631 3.07e1 SMART
WD40 633 672 4.18e-2 SMART
WD40 673 713 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161993
AA Change: V22E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124432
Gene: ENSMUSG00000032280
AA Change: V22E

DomainStartEndE-ValueType
Pfam:TLE_N 1 135 2e-77 PFAM
low complexity region 160 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162127
SMART Domains Protein: ENSMUSP00000124150
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 83 1.2e-37 PFAM
low complexity region 108 126 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
WD40 406 443 2.96e-2 SMART
WD40 449 490 4.48e-2 SMART
WD40 495 534 2.84e-4 SMART
WD40 537 576 7.55e-9 SMART
WD40 579 617 3.07e1 SMART
WD40 619 658 4.18e-2 SMART
WD40 659 699 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162583
AA Change: V22E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124977
Gene: ENSMUSG00000032280
AA Change: V22E

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 3.9e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 473 510 2.96e-2 SMART
WD40 516 557 4.48e-2 SMART
WD40 562 601 2.84e-4 SMART
WD40 604 643 7.55e-9 SMART
WD40 646 684 3.07e1 SMART
WD40 686 725 4.18e-2 SMART
WD40 726 766 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162973
AA Change: V22E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124173
Gene: ENSMUSG00000032280
AA Change: V22E

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 3.9e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 476 513 2.96e-2 SMART
WD40 519 560 4.48e-2 SMART
WD40 565 604 2.84e-4 SMART
WD40 607 646 7.55e-9 SMART
WD40 649 687 3.07e1 SMART
WD40 689 728 4.18e-2 SMART
WD40 729 769 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178113
AA Change: V22E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136010
Gene: ENSMUSG00000032280
AA Change: V22E

DomainStartEndE-ValueType
Pfam:TLE_N 1 143 6e-73 PFAM
low complexity region 171 189 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 294 313 N/A INTRINSIC
WD40 487 524 2.96e-2 SMART
WD40 530 571 4.48e-2 SMART
WD40 576 615 2.84e-4 SMART
WD40 618 657 7.55e-9 SMART
WD40 660 698 3.07e1 SMART
WD40 700 739 4.18e-2 SMART
WD40 740 780 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187131
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-repressor protein that belongs to the transducin-like enhancer family of proteins. The members of this family function in the Notch signaling pathway that regulates determination of cell fate during development. Expression of this gene has been associated with a favorable outcome to chemotherapy with taxanes for ovarian carcinoma. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homzoygous for a gene trap allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
9430007A20Rik T A 4: 144,528,811 M267K possibly damaging Het
Acsm5 T C 7: 119,534,343 S244P probably damaging Het
Actr6 A G 10: 89,714,946 F329L probably benign Het
Actrt3 A G 3: 30,598,439 S169P probably benign Het
Agtpbp1 C A 13: 59,500,072 G645C probably damaging Het
AI661453 C T 17: 47,468,555 R1069* probably null Het
Akr1c6 T C 13: 4,454,525 I303T probably benign Het
Arnt A G 3: 95,490,654 R588G probably damaging Het
Atf1 A G 15: 100,252,098 probably null Het
BC052040 A G 2: 115,670,087 probably null Het
Casp12 T C 9: 5,358,726 V318A probably damaging Het
Cblb C T 16: 52,166,029 P545L possibly damaging Het
Cc2d2a A T 5: 43,739,323 I1521F probably benign Het
Ccnb1ip1 T A 14: 50,792,144 K154* probably null Het
Cd300a A T 11: 114,893,372 K69* probably null Het
Clec10a A G 11: 70,170,025 Y78C probably damaging Het
Cnot1 T C 8: 95,763,067 I503V possibly damaging Het
Cpa2 A G 6: 30,554,293 H304R probably damaging Het
Crb2 A T 2: 37,790,245 H395L probably benign Het
Ctgf T C 10: 24,597,327 C255R probably damaging Het
Dnah8 T A 17: 30,819,139 N4257K probably damaging Het
Dnase2a G A 8: 84,908,848 D25N probably damaging Het
Drd1 T C 13: 54,053,167 T343A probably benign Het
Emid1 G A 11: 5,132,012 T161I probably benign Het
Epn2 A G 11: 61,534,576 probably null Het
Esp36 A T 17: 38,417,164 N75K possibly damaging Het
Faf1 A G 4: 109,935,549 S573G possibly damaging Het
Fam149a T G 8: 45,353,883 S231R probably damaging Het
Fam78a T C 2: 32,069,762 E112G probably damaging Het
Fgf18 T C 11: 33,134,316 D46G probably benign Het
Fggy G A 4: 95,697,076 probably null Het
Foxb1 T C 9: 69,759,577 M224V probably benign Het
Gpr75 T C 11: 30,891,808 C238R possibly damaging Het
Gsdmc3 A G 15: 63,858,273 *481R probably null Het
H2afv C A 11: 6,433,750 A57S probably damaging Het
Hsd17b11 T C 5: 103,992,882 I250V probably benign Het
Hus1 C A 11: 8,996,856 L280F probably benign Het
Ide A T 19: 37,329,070 H101Q unknown Het
Ido1 T C 8: 24,584,517 D279G probably benign Het
Inpp5b T C 4: 124,780,421 V307A probably benign Het
Ipo5 G A 14: 120,935,086 V519I probably damaging Het
Krba1 T C 6: 48,406,957 V239A probably benign Het
Lmod3 A G 6: 97,247,164 probably null Het
Macf1 T C 4: 123,499,889 D836G probably damaging Het
Malt1 G T 18: 65,476,280 C774F probably damaging Het
Map2k4 C A 11: 65,709,932 D58Y probably damaging Het
Mc2r T C 18: 68,407,340 N294S probably benign Het
Mybpc1 A G 10: 88,553,254 probably null Het
Mybpc3 A G 2: 91,126,264 E637G possibly damaging Het
Narf A G 11: 121,244,643 Q107R probably damaging Het
Nlrp3 G A 11: 59,549,238 G547D probably benign Het
Nucb2 G T 7: 116,524,305 G51* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Otog C A 7: 46,264,102 D786E probably benign Het
Otogl T C 10: 107,876,855 T543A probably damaging Het
Phf20l1 A G 15: 66,604,855 N266S probably benign Het
Pink1 G T 4: 138,315,555 S446* probably null Het
Pkp4 T G 2: 59,305,450 H186Q probably damaging Het
Prl3b1 T C 13: 27,249,477 V205A probably damaging Het
Prss32 T C 17: 23,859,183 V281A probably damaging Het
Psd3 C T 8: 68,121,169 C120Y probably damaging Het
Ptcra A G 17: 46,758,648 L99P probably damaging Het
Rab3gap2 C T 1: 185,262,829 T855I probably benign Het
Rabgap1l T C 1: 160,238,541 E199G probably damaging Het
Rbm44 T A 1: 91,155,494 C580S probably damaging Het
Rhoq T C 17: 86,995,065 V143A probably benign Het
Sacs T A 14: 61,213,797 Y4431N probably benign Het
Sec24b A T 3: 130,002,379 S367T probably benign Het
Sema4c G A 1: 36,550,185 S620F probably benign Het
Slc12a1 G A 2: 125,228,750 G1054E probably damaging Het
Slc16a3 A G 11: 120,957,968 R417G probably benign Het
Slc22a29 A T 19: 8,218,358 S106T probably benign Het
Slc41a2 T C 10: 83,313,420 T220A probably damaging Het
Tap1 T C 17: 34,193,494 F474L possibly damaging Het
Tas2r106 G T 6: 131,678,459 A143D probably benign Het
Tbx6 A T 7: 126,784,535 probably null Het
Tfap2a T A 13: 40,717,230 N402I probably damaging Het
Tmem8 T C 17: 26,120,539 F584L probably damaging Het
Trip4 T C 9: 65,858,357 I353M probably damaging Het
Ubr2 C A 17: 46,959,459 probably null Het
Ugdh A G 5: 65,423,448 probably null Het
Uhrf1 T C 17: 56,315,478 V431A probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zfp820 T C 17: 21,819,219 K376R probably benign Het
Other mutations in Tle3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Tle3 APN 9 61408757 splice site probably benign
IGL00671:Tle3 APN 9 61412370 missense probably damaging 1.00
IGL01583:Tle3 APN 9 61410025 missense probably benign 0.00
IGL01684:Tle3 APN 9 61403446 intron probably benign
IGL02109:Tle3 APN 9 61413050 missense probably damaging 1.00
IGL02386:Tle3 APN 9 61394659 missense possibly damaging 0.88
IGL02517:Tle3 APN 9 61414781 missense probably damaging 1.00
IGL02930:Tle3 APN 9 61394699 missense possibly damaging 0.52
IGL03103:Tle3 APN 9 61393242 missense possibly damaging 0.46
R0391:Tle3 UTSW 9 61416661 missense probably damaging 1.00
R0395:Tle3 UTSW 9 61410071 missense probably damaging 0.99
R0621:Tle3 UTSW 9 61410105 nonsense probably null
R1836:Tle3 UTSW 9 61414023 missense probably damaging 1.00
R1921:Tle3 UTSW 9 61411340 critical splice donor site probably null
R1978:Tle3 UTSW 9 61394633 missense probably damaging 1.00
R3434:Tle3 UTSW 9 61414094 unclassified probably null
R4242:Tle3 UTSW 9 61407423 missense probably benign
R4587:Tle3 UTSW 9 61374013 missense probably damaging 0.99
R4811:Tle3 UTSW 9 61373997 unclassified probably benign
R4877:Tle3 UTSW 9 61373499 intron probably benign
R5387:Tle3 UTSW 9 61407489 intron probably null
R5745:Tle3 UTSW 9 61414851 missense probably damaging 1.00
R5752:Tle3 UTSW 9 61407471 missense probably damaging 1.00
R5917:Tle3 UTSW 9 61408908 missense probably benign 0.19
R6000:Tle3 UTSW 9 61374014 missense probably damaging 1.00
R6339:Tle3 UTSW 9 61401924 synonymous probably null
R7210:Tle3 UTSW 9 61412305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTTGCTGGGAAGGTTCTGG -3'
(R):5'- ACGCAAAGGGTTAAGGCTGC -3'

Sequencing Primer
(F):5'- CTGGGAAGGTTCTGGGCTGTG -3'
(R):5'- CCTTACCTGTGATACTGAGC -3'
Posted On2016-04-15