Incidental Mutation 'R4913:Actr6'
ID379718
Institutional Source Beutler Lab
Gene Symbol Actr6
Ensembl Gene ENSMUSG00000019948
Gene NameARP6 actin-related protein 6
SynonymsArpX, Arp6, CDA12, 2010200J04Rik
MMRRC Submission 042515-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4913 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location89711971-89732295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89714946 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 329 (F329L)
Ref Sequence ENSEMBL: ENSMUSP00000020109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020109]
Predicted Effect probably benign
Transcript: ENSMUST00000020109
AA Change: F329L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020109
Gene: ENSMUSG00000019948
AA Change: F329L

DomainStartEndE-ValueType
ACTIN 1 395 1.09e-110 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
9430007A20Rik T A 4: 144,528,811 M267K possibly damaging Het
Acsm5 T C 7: 119,534,343 S244P probably damaging Het
Actrt3 A G 3: 30,598,439 S169P probably benign Het
Agtpbp1 C A 13: 59,500,072 G645C probably damaging Het
AI661453 C T 17: 47,468,555 R1069* probably null Het
Akr1c6 T C 13: 4,454,525 I303T probably benign Het
Arnt A G 3: 95,490,654 R588G probably damaging Het
Atf1 A G 15: 100,252,098 probably null Het
BC052040 A G 2: 115,670,087 probably null Het
Casp12 T C 9: 5,358,726 V318A probably damaging Het
Cblb C T 16: 52,166,029 P545L possibly damaging Het
Cc2d2a A T 5: 43,739,323 I1521F probably benign Het
Ccnb1ip1 T A 14: 50,792,144 K154* probably null Het
Cd300a A T 11: 114,893,372 K69* probably null Het
Clec10a A G 11: 70,170,025 Y78C probably damaging Het
Cnot1 T C 8: 95,763,067 I503V possibly damaging Het
Cpa2 A G 6: 30,554,293 H304R probably damaging Het
Crb2 A T 2: 37,790,245 H395L probably benign Het
Ctgf T C 10: 24,597,327 C255R probably damaging Het
Dnah8 T A 17: 30,819,139 N4257K probably damaging Het
Dnase2a G A 8: 84,908,848 D25N probably damaging Het
Drd1 T C 13: 54,053,167 T343A probably benign Het
Emid1 G A 11: 5,132,012 T161I probably benign Het
Epn2 A G 11: 61,534,576 probably null Het
Esp36 A T 17: 38,417,164 N75K possibly damaging Het
Faf1 A G 4: 109,935,549 S573G possibly damaging Het
Fam149a T G 8: 45,353,883 S231R probably damaging Het
Fam78a T C 2: 32,069,762 E112G probably damaging Het
Fgf18 T C 11: 33,134,316 D46G probably benign Het
Fggy G A 4: 95,697,076 probably null Het
Foxb1 T C 9: 69,759,577 M224V probably benign Het
Gpr75 T C 11: 30,891,808 C238R possibly damaging Het
Gsdmc3 A G 15: 63,858,273 *481R probably null Het
H2afv C A 11: 6,433,750 A57S probably damaging Het
Hsd17b11 T C 5: 103,992,882 I250V probably benign Het
Hus1 C A 11: 8,996,856 L280F probably benign Het
Ide A T 19: 37,329,070 H101Q unknown Het
Ido1 T C 8: 24,584,517 D279G probably benign Het
Inpp5b T C 4: 124,780,421 V307A probably benign Het
Ipo5 G A 14: 120,935,086 V519I probably damaging Het
Krba1 T C 6: 48,406,957 V239A probably benign Het
Lmod3 A G 6: 97,247,164 probably null Het
Macf1 T C 4: 123,499,889 D836G probably damaging Het
Malt1 G T 18: 65,476,280 C774F probably damaging Het
Map2k4 C A 11: 65,709,932 D58Y probably damaging Het
Mc2r T C 18: 68,407,340 N294S probably benign Het
Mybpc1 A G 10: 88,553,254 probably null Het
Mybpc3 A G 2: 91,126,264 E637G possibly damaging Het
Narf A G 11: 121,244,643 Q107R probably damaging Het
Nlrp3 G A 11: 59,549,238 G547D probably benign Het
Nucb2 G T 7: 116,524,305 G51* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Otog C A 7: 46,264,102 D786E probably benign Het
Otogl T C 10: 107,876,855 T543A probably damaging Het
Phf20l1 A G 15: 66,604,855 N266S probably benign Het
Pink1 G T 4: 138,315,555 S446* probably null Het
Pkp4 T G 2: 59,305,450 H186Q probably damaging Het
Prl3b1 T C 13: 27,249,477 V205A probably damaging Het
Prss32 T C 17: 23,859,183 V281A probably damaging Het
Psd3 C T 8: 68,121,169 C120Y probably damaging Het
Ptcra A G 17: 46,758,648 L99P probably damaging Het
Rab3gap2 C T 1: 185,262,829 T855I probably benign Het
Rabgap1l T C 1: 160,238,541 E199G probably damaging Het
Rbm44 T A 1: 91,155,494 C580S probably damaging Het
Rhoq T C 17: 86,995,065 V143A probably benign Het
Sacs T A 14: 61,213,797 Y4431N probably benign Het
Sec24b A T 3: 130,002,379 S367T probably benign Het
Sema4c G A 1: 36,550,185 S620F probably benign Het
Slc12a1 G A 2: 125,228,750 G1054E probably damaging Het
Slc16a3 A G 11: 120,957,968 R417G probably benign Het
Slc22a29 A T 19: 8,218,358 S106T probably benign Het
Slc41a2 T C 10: 83,313,420 T220A probably damaging Het
Tap1 T C 17: 34,193,494 F474L possibly damaging Het
Tas2r106 G T 6: 131,678,459 A143D probably benign Het
Tbx6 A T 7: 126,784,535 probably null Het
Tfap2a T A 13: 40,717,230 N402I probably damaging Het
Tle3 T A 9: 61,373,993 V22E probably damaging Het
Tmem8 T C 17: 26,120,539 F584L probably damaging Het
Trip4 T C 9: 65,858,357 I353M probably damaging Het
Ubr2 C A 17: 46,959,459 probably null Het
Ugdh A G 5: 65,423,448 probably null Het
Uhrf1 T C 17: 56,315,478 V431A probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zfp820 T C 17: 21,819,219 K376R probably benign Het
Other mutations in Actr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Actr6 APN 10 89725841 missense probably damaging 0.99
IGL01420:Actr6 APN 10 89725165 unclassified probably benign
IGL02387:Actr6 APN 10 89714984 missense probably damaging 1.00
IGL03073:Actr6 APN 10 89726694 missense probably damaging 1.00
Exalt UTSW 10 89732202 nonsense probably null
R0145:Actr6 UTSW 10 89728178 nonsense probably null
R1413:Actr6 UTSW 10 89728157 nonsense probably null
R1611:Actr6 UTSW 10 89732202 nonsense probably null
R4271:Actr6 UTSW 10 89717239 missense probably benign 0.10
R4492:Actr6 UTSW 10 89725814 missense probably benign 0.01
R4976:Actr6 UTSW 10 89725855 missense probably damaging 1.00
R5119:Actr6 UTSW 10 89725855 missense probably damaging 1.00
R5767:Actr6 UTSW 10 89726755 missense probably damaging 0.99
R5946:Actr6 UTSW 10 89728192 missense probably benign 0.00
R6443:Actr6 UTSW 10 89714871 missense probably damaging 0.98
R6913:Actr6 UTSW 10 89726696 missense probably damaging 1.00
R7196:Actr6 UTSW 10 89714922 missense possibly damaging 0.89
R7201:Actr6 UTSW 10 89712512 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTCAAGAACTGAGGTTTCATGTTTG -3'
(R):5'- TTAACAACGGACCCCAGGTG -3'

Sequencing Primer
(F):5'- AATCCTGTTGGGGGATAAATCTGCC -3'
(R):5'- GGTTTGGTTTCCCAGCCACG -3'
Posted On2016-04-15