Incidental Mutation 'R4913:Ipo5'
ID379740
Institutional Source Beutler Lab
Gene Symbol Ipo5
Ensembl Gene ENSMUSG00000030662
Gene Nameimportin 5
SynonymsRanbp5, Kpnb3, 5730478E03Rik, IMB3, 1110011C18Rik
MMRRC Submission 042515-MU
Accession Numbers

Genbank: NM_023579; MGI: 1917822

Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R4913 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location120911224-120947999 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120935086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 519 (V519I)
Ref Sequence ENSEMBL: ENSMUSP00000032898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032898]
Predicted Effect probably damaging
Transcript: ENSMUST00000032898
AA Change: V519I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032898
Gene: ENSMUSG00000030662
AA Change: V519I

DomainStartEndE-ValueType
low complexity region 65 72 N/A INTRINSIC
Pfam:HEAT_2 359 467 3.3e-13 PFAM
Pfam:HEAT_EZ 372 426 3.7e-10 PFAM
Pfam:Vac14_Fab1_bd 373 430 3.8e-9 PFAM
Pfam:HEAT 400 430 4.2e-7 PFAM
Pfam:HEAT 906 936 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228277
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(33) : Targeted, other(2) Gene trapped(31)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
9430007A20Rik T A 4: 144,528,811 M267K possibly damaging Het
Acsm5 T C 7: 119,534,343 S244P probably damaging Het
Actr6 A G 10: 89,714,946 F329L probably benign Het
Actrt3 A G 3: 30,598,439 S169P probably benign Het
Agtpbp1 C A 13: 59,500,072 G645C probably damaging Het
AI661453 C T 17: 47,468,555 R1069* probably null Het
Akr1c6 T C 13: 4,454,525 I303T probably benign Het
Arnt A G 3: 95,490,654 R588G probably damaging Het
Atf1 A G 15: 100,252,098 probably null Het
BC052040 A G 2: 115,670,087 probably null Het
Casp12 T C 9: 5,358,726 V318A probably damaging Het
Cblb C T 16: 52,166,029 P545L possibly damaging Het
Cc2d2a A T 5: 43,739,323 I1521F probably benign Het
Ccnb1ip1 T A 14: 50,792,144 K154* probably null Het
Cd300a A T 11: 114,893,372 K69* probably null Het
Clec10a A G 11: 70,170,025 Y78C probably damaging Het
Cnot1 T C 8: 95,763,067 I503V possibly damaging Het
Cpa2 A G 6: 30,554,293 H304R probably damaging Het
Crb2 A T 2: 37,790,245 H395L probably benign Het
Ctgf T C 10: 24,597,327 C255R probably damaging Het
Dnah8 T A 17: 30,819,139 N4257K probably damaging Het
Dnase2a G A 8: 84,908,848 D25N probably damaging Het
Drd1 T C 13: 54,053,167 T343A probably benign Het
Emid1 G A 11: 5,132,012 T161I probably benign Het
Epn2 A G 11: 61,534,576 probably null Het
Esp36 A T 17: 38,417,164 N75K possibly damaging Het
Faf1 A G 4: 109,935,549 S573G possibly damaging Het
Fam149a T G 8: 45,353,883 S231R probably damaging Het
Fam78a T C 2: 32,069,762 E112G probably damaging Het
Fgf18 T C 11: 33,134,316 D46G probably benign Het
Fggy G A 4: 95,697,076 probably null Het
Foxb1 T C 9: 69,759,577 M224V probably benign Het
Gpr75 T C 11: 30,891,808 C238R possibly damaging Het
Gsdmc3 A G 15: 63,858,273 *481R probably null Het
H2afv C A 11: 6,433,750 A57S probably damaging Het
Hsd17b11 T C 5: 103,992,882 I250V probably benign Het
Hus1 C A 11: 8,996,856 L280F probably benign Het
Ide A T 19: 37,329,070 H101Q unknown Het
Ido1 T C 8: 24,584,517 D279G probably benign Het
Inpp5b T C 4: 124,780,421 V307A probably benign Het
Krba1 T C 6: 48,406,957 V239A probably benign Het
Lmod3 A G 6: 97,247,164 probably null Het
Macf1 T C 4: 123,499,889 D836G probably damaging Het
Malt1 G T 18: 65,476,280 C774F probably damaging Het
Map2k4 C A 11: 65,709,932 D58Y probably damaging Het
Mc2r T C 18: 68,407,340 N294S probably benign Het
Mybpc1 A G 10: 88,553,254 probably null Het
Mybpc3 A G 2: 91,126,264 E637G possibly damaging Het
Narf A G 11: 121,244,643 Q107R probably damaging Het
Nlrp3 G A 11: 59,549,238 G547D probably benign Het
Nucb2 G T 7: 116,524,305 G51* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Otog C A 7: 46,264,102 D786E probably benign Het
Otogl T C 10: 107,876,855 T543A probably damaging Het
Phf20l1 A G 15: 66,604,855 N266S probably benign Het
Pink1 G T 4: 138,315,555 S446* probably null Het
Pkp4 T G 2: 59,305,450 H186Q probably damaging Het
Prl3b1 T C 13: 27,249,477 V205A probably damaging Het
Prss32 T C 17: 23,859,183 V281A probably damaging Het
Psd3 C T 8: 68,121,169 C120Y probably damaging Het
Ptcra A G 17: 46,758,648 L99P probably damaging Het
Rab3gap2 C T 1: 185,262,829 T855I probably benign Het
Rabgap1l T C 1: 160,238,541 E199G probably damaging Het
Rbm44 T A 1: 91,155,494 C580S probably damaging Het
Rhoq T C 17: 86,995,065 V143A probably benign Het
Sacs T A 14: 61,213,797 Y4431N probably benign Het
Sec24b A T 3: 130,002,379 S367T probably benign Het
Sema4c G A 1: 36,550,185 S620F probably benign Het
Slc12a1 G A 2: 125,228,750 G1054E probably damaging Het
Slc16a3 A G 11: 120,957,968 R417G probably benign Het
Slc22a29 A T 19: 8,218,358 S106T probably benign Het
Slc41a2 T C 10: 83,313,420 T220A probably damaging Het
Tap1 T C 17: 34,193,494 F474L possibly damaging Het
Tas2r106 G T 6: 131,678,459 A143D probably benign Het
Tbx6 A T 7: 126,784,535 probably null Het
Tfap2a T A 13: 40,717,230 N402I probably damaging Het
Tle3 T A 9: 61,373,993 V22E probably damaging Het
Tmem8 T C 17: 26,120,539 F584L probably damaging Het
Trip4 T C 9: 65,858,357 I353M probably damaging Het
Ubr2 C A 17: 46,959,459 probably null Het
Ugdh A G 5: 65,423,448 probably null Het
Uhrf1 T C 17: 56,315,478 V431A probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zfp820 T C 17: 21,819,219 K376R probably benign Het
Other mutations in Ipo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Ipo5 APN 14 120928533 missense probably damaging 0.98
IGL01614:Ipo5 APN 14 120935095 missense probably benign 0.01
IGL01835:Ipo5 APN 14 120926238 missense probably benign 0.24
IGL02010:Ipo5 APN 14 120933377 missense probably benign 0.20
IGL02303:Ipo5 APN 14 120917383 missense probably benign
IGL02344:Ipo5 APN 14 120942779 splice site probably benign
IGL02657:Ipo5 APN 14 120943800 missense possibly damaging 0.47
IGL03094:Ipo5 APN 14 120943677 splice site probably benign
IGL03158:Ipo5 APN 14 120941891 splice site probably benign
IGL03309:Ipo5 APN 14 120920004 missense probably benign
IGL03392:Ipo5 APN 14 120942687 missense probably damaging 0.99
3-1:Ipo5 UTSW 14 120932936 missense probably benign 0.41
PIT4544001:Ipo5 UTSW 14 120928537 missense probably damaging 0.99
R0326:Ipo5 UTSW 14 120922223 missense probably benign 0.19
R0505:Ipo5 UTSW 14 120942733 missense possibly damaging 0.74
R0559:Ipo5 UTSW 14 120938641 missense probably damaging 1.00
R0590:Ipo5 UTSW 14 120944357 missense possibly damaging 0.76
R0969:Ipo5 UTSW 14 120944525 missense possibly damaging 0.64
R1450:Ipo5 UTSW 14 120944393 missense probably benign 0.04
R1672:Ipo5 UTSW 14 120933302 missense probably damaging 1.00
R2471:Ipo5 UTSW 14 120922162 missense probably benign 0.12
R3508:Ipo5 UTSW 14 120939544 missense probably damaging 1.00
R3696:Ipo5 UTSW 14 120922162 missense probably benign 0.12
R4118:Ipo5 UTSW 14 120938661 missense probably benign 0.04
R4418:Ipo5 UTSW 14 120943893 missense possibly damaging 0.81
R4760:Ipo5 UTSW 14 120941642 missense probably benign 0.02
R4839:Ipo5 UTSW 14 120920038 missense probably benign 0.00
R5326:Ipo5 UTSW 14 120926271 missense probably benign
R5339:Ipo5 UTSW 14 120943710 missense probably damaging 1.00
R5483:Ipo5 UTSW 14 120920038 missense probably benign 0.06
R5542:Ipo5 UTSW 14 120926271 missense probably benign
R5579:Ipo5 UTSW 14 120938613 missense probably benign 0.26
R5954:Ipo5 UTSW 14 120919984 missense probably damaging 1.00
R6948:Ipo5 UTSW 14 120923115 missense probably benign 0.00
R7365:Ipo5 UTSW 14 120920085 missense probably benign
W0251:Ipo5 UTSW 14 120938785 missense probably benign 0.17
X0062:Ipo5 UTSW 14 120941671 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGACTTCTGGAAGGGTGGC -3'
(R):5'- ACTGTTGACTCTACAGAAAACACAG -3'

Sequencing Primer
(F):5'- ACTTCTGGAAGGGTGGCCATAATATC -3'
(R):5'- ATGCTACCAAGAGCCGGTCTG -3'
Posted On2016-04-15