Incidental Mutation 'R4914:Emc1'
ID379792
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
MMRRC Submission 042516-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4914 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 139375165 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 924 (R924*)
Ref Sequence ENSEMBL: ENSMUSP00000137103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect probably null
Transcript: ENSMUST00000042096
AA Change: R921*
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: R921*

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000082262
AA Change: R924*
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: R924*

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably null
Transcript: ENSMUST00000179784
AA Change: R924*
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: R924*

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181556
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A G 5: 109,678,530 S59P probably damaging Het
Ace G A 11: 105,979,597 V281M probably damaging Het
Ap1b1 C T 11: 5,024,400 T363I possibly damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arhgef1 T A 7: 24,923,839 L436Q probably damaging Het
Atxn2 T A 5: 121,749,096 D276E probably damaging Het
AU040320 A T 4: 126,835,676 K544* probably null Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A G 13: 100,056,336 V1330A probably benign Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cabs1 T C 5: 87,980,437 Y316H probably damaging Het
Carmil2 A G 8: 105,693,543 K908E possibly damaging Het
Ccdc188 C A 16: 18,218,219 P86Q probably benign Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dclk2 A T 3: 86,824,742 probably null Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dpp4 A T 2: 62,347,892 M632K probably benign Het
E030030I06Rik G A 10: 22,114,298 T192M possibly damaging Het
Ece2 C T 16: 20,644,070 R582C probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Etaa1 A T 11: 17,946,532 S528R probably benign Het
Exoc2 A T 13: 30,876,813 N569K probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fbxw16 C T 9: 109,438,177 V329I probably benign Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fermt1 A G 2: 132,906,840 V621A probably damaging Het
Fnbp4 A G 2: 90,751,169 T189A probably benign Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
G6pd2 T A 5: 61,810,329 Y482* probably null Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gper1 A G 5: 139,426,868 I323V probably benign Het
Grm5 C A 7: 88,130,129 R958S probably benign Het
H2-DMb2 A G 17: 34,150,529 T85A probably benign Het
Hgsnat A G 8: 25,964,838 S220P probably damaging Het
Hspa12a A T 19: 58,799,452 M646K probably damaging Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Jmjd1c A G 10: 67,218,971 N344D probably damaging Het
Kif1c A G 11: 70,708,855 E471G probably damaging Het
Lalba T A 15: 98,482,180 N63I probably benign Het
Mcoln1 T A 8: 3,507,483 L163* probably null Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mpzl2 T A 9: 45,043,848 D114E probably benign Het
Myef2 T A 2: 125,109,739 K259* probably null Het
Myh8 C A 11: 67,292,684 D740E probably damaging Het
Myo1b A T 1: 51,824,208 probably null Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Olfr1369-ps1 A T 13: 21,116,397 Q235L probably benign Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr362 A T 2: 37,105,158 I164N possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Olfr90 T C 17: 37,085,991 Y58C probably damaging Het
Orc1 T C 4: 108,604,558 F584S probably damaging Het
Osgin1 C A 8: 119,442,544 A60D possibly damaging Het
Pde4dip C A 3: 97,715,328 V1522L probably benign Het
Phactr1 A G 13: 43,133,963 T556A possibly damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Ppp1r1a A G 15: 103,537,838 V14A probably damaging Het
Prkcd A T 14: 30,605,438 probably null Het
Ranbp17 T C 11: 33,213,425 S1082G probably benign Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rnf103 T A 6: 71,510,264 F626L possibly damaging Het
Rsrc2 A G 5: 123,739,550 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Slain2 T A 5: 72,958,266 M448K probably benign Het
Slc25a54 T C 3: 109,111,079 F292L probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slco1b2 G A 6: 141,669,370 V334I probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Smg8 T C 11: 87,080,710 E745G probably damaging Het
Smyd1 T G 6: 71,219,337 I322L probably benign Het
Snx13 G A 12: 35,132,033 V694I possibly damaging Het
Sox6 T C 7: 115,476,964 D814G probably damaging Het
Spag6 A T 2: 18,745,549 I469F probably benign Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Srprb C A 9: 103,201,948 V747L possibly damaging Het
Stam A G 2: 14,102,416 E16G probably damaging Het
Taar5 A T 10: 23,971,570 I289F possibly damaging Het
Tgif1 C T 17: 70,845,247 R70H probably damaging Het
Tmem2 G A 19: 21,809,289 V472I probably benign Het
Top2a A T 11: 99,002,960 L1036H probably damaging Het
Tph1 T A 7: 46,653,859 I232F probably damaging Het
Ttn T C 2: 76,746,831 T24573A probably damaging Het
Tub C T 7: 109,020,954 R102* probably null Het
Ube2n T A 10: 95,541,745 W129R possibly damaging Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Vmn2r81 A T 10: 79,270,523 K445M probably null Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Wdr63 A G 3: 146,066,827 I488T probably damaging Het
Zfp157 T C 5: 138,456,295 S252P possibly damaging Het
Zfp605 T A 5: 110,127,701 C228* probably null Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCCTCAGAGGAAATTCAGG -3'
(R):5'- CTTGGACGGGTAAACTCGAG -3'

Sequencing Primer
(F):5'- CCTCAGAGGAAATTCAGGTTTAGTG -3'
(R):5'- CTCGAGTTTGGTAAATATCCAAACCG -3'
Posted On2016-04-15