Incidental Mutation 'R4914:Osgin1'
ID379825
Institutional Source Beutler Lab
Gene Symbol Osgin1
Ensembl Gene ENSMUSG00000074063
Gene Nameoxidative stress induced growth inhibitor 1
Synonyms1700012B18Rik
MMRRC Submission 042516-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R4914 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location119434124-119446256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119442544 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 60 (A60D)
Ref Sequence ENSEMBL: ENSMUSP00000120477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098363] [ENSMUST00000098365] [ENSMUST00000131448] [ENSMUST00000152420] [ENSMUST00000212112]
Predicted Effect probably benign
Transcript: ENSMUST00000098363
SMART Domains Protein: ENSMUSP00000095966
Gene: ENSMUSG00000031837

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
EFh 67 95 4.06e-2 SMART
EFh 101 129 3.21e0 SMART
low complexity region 185 196 N/A INTRINSIC
Pfam:ABM 289 363 2.1e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098365
AA Change: A60D

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126414
Predicted Effect possibly damaging
Transcript: ENSMUST00000131448
AA Change: A60D

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120477
Gene: ENSMUSG00000074063
AA Change: A60D

DomainStartEndE-ValueType
SCOP:d1foha5 12 38 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145604
Predicted Effect possibly damaging
Transcript: ENSMUST00000152420
AA Change: A60D

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114467
Gene: ENSMUSG00000074063
AA Change: A60D

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 205 465 3e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212112
AA Change: A38D

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an oxidative stress response protein that regulates cell death. Expression of the gene is regulated by p53 and is induced by DNA damage. The protein regulates apoptosis by inducing cytochrome c release from mitochondria. It also appears to be a key regulator of both inflammatory and anti-inflammatory molecules. The loss of this protein correlates with uncontrolled cell growth and tumor formation. Naturally occurring read-through transcription exists between this gene and the neighboring upstream malonyl-CoA decarboxylase (MLYCD) gene, but the read-through transcripts are unlikely to produce a protein product. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A G 5: 109,678,530 S59P probably damaging Het
Ace G A 11: 105,979,597 V281M probably damaging Het
Ap1b1 C T 11: 5,024,400 T363I possibly damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arhgef1 T A 7: 24,923,839 L436Q probably damaging Het
Atxn2 T A 5: 121,749,096 D276E probably damaging Het
AU040320 A T 4: 126,835,676 K544* probably null Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A G 13: 100,056,336 V1330A probably benign Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cabs1 T C 5: 87,980,437 Y316H probably damaging Het
Carmil2 A G 8: 105,693,543 K908E possibly damaging Het
Ccdc188 C A 16: 18,218,219 P86Q probably benign Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dclk2 A T 3: 86,824,742 probably null Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dpp4 A T 2: 62,347,892 M632K probably benign Het
E030030I06Rik G A 10: 22,114,298 T192M possibly damaging Het
Ece2 C T 16: 20,644,070 R582C probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Emc1 C T 4: 139,375,165 R924* probably null Het
Etaa1 A T 11: 17,946,532 S528R probably benign Het
Exoc2 A T 13: 30,876,813 N569K probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fbxw16 C T 9: 109,438,177 V329I probably benign Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fermt1 A G 2: 132,906,840 V621A probably damaging Het
Fnbp4 A G 2: 90,751,169 T189A probably benign Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
G6pd2 T A 5: 61,810,329 Y482* probably null Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gper1 A G 5: 139,426,868 I323V probably benign Het
Grm5 C A 7: 88,130,129 R958S probably benign Het
H2-DMb2 A G 17: 34,150,529 T85A probably benign Het
Hgsnat A G 8: 25,964,838 S220P probably damaging Het
Hspa12a A T 19: 58,799,452 M646K probably damaging Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Jmjd1c A G 10: 67,218,971 N344D probably damaging Het
Kif1c A G 11: 70,708,855 E471G probably damaging Het
Lalba T A 15: 98,482,180 N63I probably benign Het
Mcoln1 T A 8: 3,507,483 L163* probably null Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mpzl2 T A 9: 45,043,848 D114E probably benign Het
Myef2 T A 2: 125,109,739 K259* probably null Het
Myh8 C A 11: 67,292,684 D740E probably damaging Het
Myo1b A T 1: 51,824,208 probably null Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Olfr1369-ps1 A T 13: 21,116,397 Q235L probably benign Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr362 A T 2: 37,105,158 I164N possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Olfr90 T C 17: 37,085,991 Y58C probably damaging Het
Orc1 T C 4: 108,604,558 F584S probably damaging Het
Pde4dip C A 3: 97,715,328 V1522L probably benign Het
Phactr1 A G 13: 43,133,963 T556A possibly damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Ppp1r1a A G 15: 103,537,838 V14A probably damaging Het
Prkcd A T 14: 30,605,438 probably null Het
Ranbp17 T C 11: 33,213,425 S1082G probably benign Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rnf103 T A 6: 71,510,264 F626L possibly damaging Het
Rsrc2 A G 5: 123,739,550 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Slain2 T A 5: 72,958,266 M448K probably benign Het
Slc25a54 T C 3: 109,111,079 F292L probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slco1b2 G A 6: 141,669,370 V334I probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Smg8 T C 11: 87,080,710 E745G probably damaging Het
Smyd1 T G 6: 71,219,337 I322L probably benign Het
Snx13 G A 12: 35,132,033 V694I possibly damaging Het
Sox6 T C 7: 115,476,964 D814G probably damaging Het
Spag6 A T 2: 18,745,549 I469F probably benign Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Srprb C A 9: 103,201,948 V747L possibly damaging Het
Stam A G 2: 14,102,416 E16G probably damaging Het
Taar5 A T 10: 23,971,570 I289F possibly damaging Het
Tgif1 C T 17: 70,845,247 R70H probably damaging Het
Tmem2 G A 19: 21,809,289 V472I probably benign Het
Top2a A T 11: 99,002,960 L1036H probably damaging Het
Tph1 T A 7: 46,653,859 I232F probably damaging Het
Ttn T C 2: 76,746,831 T24573A probably damaging Het
Tub C T 7: 109,020,954 R102* probably null Het
Ube2n T A 10: 95,541,745 W129R possibly damaging Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Vmn2r81 A T 10: 79,270,523 K445M probably null Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Wdr63 A G 3: 146,066,827 I488T probably damaging Het
Zfp157 T C 5: 138,456,295 S252P possibly damaging Het
Zfp605 T A 5: 110,127,701 C228* probably null Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Osgin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Osgin1 APN 8 119445046 missense probably damaging 0.97
IGL02347:Osgin1 APN 8 119445538 missense probably benign 0.02
IGL02803:Osgin1 APN 8 119443267 missense probably benign 0.00
IGL03111:Osgin1 APN 8 119443049 missense probably damaging 0.96
R0137:Osgin1 UTSW 8 119442480 missense possibly damaging 0.73
R0265:Osgin1 UTSW 8 119445657 missense possibly damaging 0.94
R0520:Osgin1 UTSW 8 119442508 missense probably damaging 1.00
R0650:Osgin1 UTSW 8 119445472 missense probably damaging 1.00
R0652:Osgin1 UTSW 8 119445472 missense probably damaging 1.00
R0687:Osgin1 UTSW 8 119445832 missense probably damaging 1.00
R1439:Osgin1 UTSW 8 119443113 splice site probably null
R1469:Osgin1 UTSW 8 119445385 missense possibly damaging 0.95
R1469:Osgin1 UTSW 8 119445385 missense possibly damaging 0.95
R1470:Osgin1 UTSW 8 119444965 missense probably damaging 1.00
R1470:Osgin1 UTSW 8 119444965 missense probably damaging 1.00
R2058:Osgin1 UTSW 8 119445673 missense possibly damaging 0.87
R2982:Osgin1 UTSW 8 119442535 missense probably damaging 1.00
R3880:Osgin1 UTSW 8 119441452 missense probably benign
R4076:Osgin1 UTSW 8 119445033 missense possibly damaging 0.64
R4594:Osgin1 UTSW 8 119445253 missense possibly damaging 0.49
R4991:Osgin1 UTSW 8 119445289 missense probably damaging 1.00
R5689:Osgin1 UTSW 8 119444989 makesense probably null
R6215:Osgin1 UTSW 8 119445444 missense probably benign 0.01
R7008:Osgin1 UTSW 8 119441494 missense possibly damaging 0.92
R7136:Osgin1 UTSW 8 119441437 start codon destroyed probably null 0.51
R7380:Osgin1 UTSW 8 119445431 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGGCATCTGTCGCAGAGTAAG -3'
(R):5'- AGCACGGGTCTAATGTGAGG -3'

Sequencing Primer
(F):5'- CATCTGTCGCAGAGTAAGGGCTTAG -3'
(R):5'- TCTAATGTGAGGTCAGACAGCTG -3'
Posted On2016-04-15