Incidental Mutation 'R4914:Bdp1'
ID379858
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene NameB double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
SynonymsTAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik
MMRRC Submission 042516-MU
Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4914 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100017994-100104070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100056336 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1330 (V1330A)
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
Predicted Effect probably benign
Transcript: ENSMUST00000038104
AA Change: V1330A

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: V1330A

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099262
Predicted Effect probably benign
Transcript: ENSMUST00000109379
AA Change: V1330A

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: V1330A

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A G 5: 109,678,530 S59P probably damaging Het
Ace G A 11: 105,979,597 V281M probably damaging Het
Ap1b1 C T 11: 5,024,400 T363I possibly damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arhgef1 T A 7: 24,923,839 L436Q probably damaging Het
Atxn2 T A 5: 121,749,096 D276E probably damaging Het
AU040320 A T 4: 126,835,676 K544* probably null Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cabs1 T C 5: 87,980,437 Y316H probably damaging Het
Carmil2 A G 8: 105,693,543 K908E possibly damaging Het
Ccdc188 C A 16: 18,218,219 P86Q probably benign Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dclk2 A T 3: 86,824,742 probably null Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dpp4 A T 2: 62,347,892 M632K probably benign Het
E030030I06Rik G A 10: 22,114,298 T192M possibly damaging Het
Ece2 C T 16: 20,644,070 R582C probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Emc1 C T 4: 139,375,165 R924* probably null Het
Etaa1 A T 11: 17,946,532 S528R probably benign Het
Exoc2 A T 13: 30,876,813 N569K probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fbxw16 C T 9: 109,438,177 V329I probably benign Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fermt1 A G 2: 132,906,840 V621A probably damaging Het
Fnbp4 A G 2: 90,751,169 T189A probably benign Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
G6pd2 T A 5: 61,810,329 Y482* probably null Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gper1 A G 5: 139,426,868 I323V probably benign Het
Grm5 C A 7: 88,130,129 R958S probably benign Het
H2-DMb2 A G 17: 34,150,529 T85A probably benign Het
Hgsnat A G 8: 25,964,838 S220P probably damaging Het
Hspa12a A T 19: 58,799,452 M646K probably damaging Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Jmjd1c A G 10: 67,218,971 N344D probably damaging Het
Kif1c A G 11: 70,708,855 E471G probably damaging Het
Lalba T A 15: 98,482,180 N63I probably benign Het
Mcoln1 T A 8: 3,507,483 L163* probably null Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mpzl2 T A 9: 45,043,848 D114E probably benign Het
Myef2 T A 2: 125,109,739 K259* probably null Het
Myh8 C A 11: 67,292,684 D740E probably damaging Het
Myo1b A T 1: 51,824,208 probably null Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Olfr1369-ps1 A T 13: 21,116,397 Q235L probably benign Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr362 A T 2: 37,105,158 I164N possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Olfr90 T C 17: 37,085,991 Y58C probably damaging Het
Orc1 T C 4: 108,604,558 F584S probably damaging Het
Osgin1 C A 8: 119,442,544 A60D possibly damaging Het
Pde4dip C A 3: 97,715,328 V1522L probably benign Het
Phactr1 A G 13: 43,133,963 T556A possibly damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Ppp1r1a A G 15: 103,537,838 V14A probably damaging Het
Prkcd A T 14: 30,605,438 probably null Het
Ranbp17 T C 11: 33,213,425 S1082G probably benign Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rnf103 T A 6: 71,510,264 F626L possibly damaging Het
Rsrc2 A G 5: 123,739,550 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Slain2 T A 5: 72,958,266 M448K probably benign Het
Slc25a54 T C 3: 109,111,079 F292L probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slco1b2 G A 6: 141,669,370 V334I probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Smg8 T C 11: 87,080,710 E745G probably damaging Het
Smyd1 T G 6: 71,219,337 I322L probably benign Het
Snx13 G A 12: 35,132,033 V694I possibly damaging Het
Sox6 T C 7: 115,476,964 D814G probably damaging Het
Spag6 A T 2: 18,745,549 I469F probably benign Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Srprb C A 9: 103,201,948 V747L possibly damaging Het
Stam A G 2: 14,102,416 E16G probably damaging Het
Taar5 A T 10: 23,971,570 I289F possibly damaging Het
Tgif1 C T 17: 70,845,247 R70H probably damaging Het
Tmem2 G A 19: 21,809,289 V472I probably benign Het
Top2a A T 11: 99,002,960 L1036H probably damaging Het
Tph1 T A 7: 46,653,859 I232F probably damaging Het
Ttn T C 2: 76,746,831 T24573A probably damaging Het
Tub C T 7: 109,020,954 R102* probably null Het
Ube2n T A 10: 95,541,745 W129R possibly damaging Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Vmn2r81 A T 10: 79,270,523 K445M probably null Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Wdr63 A G 3: 146,066,827 I488T probably damaging Het
Zfp157 T C 5: 138,456,295 S252P possibly damaging Het
Zfp605 T A 5: 110,127,701 C228* probably null Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100098510 missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100060865 missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100061198 missense probably benign 0.00
IGL00924:Bdp1 APN 13 100097579 missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100056192 missense probably benign 0.00
IGL01344:Bdp1 APN 13 100078080 missense probably benign 0.06
IGL01347:Bdp1 APN 13 100070203 missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100084205 splice site probably benign
IGL01871:Bdp1 APN 13 100066053 missense probably benign 0.01
IGL02008:Bdp1 APN 13 100023827 missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100037800 missense probably benign 0.02
IGL02214:Bdp1 APN 13 100041535 missense probably benign 0.00
IGL02236:Bdp1 APN 13 100060891 missense probably benign
IGL02307:Bdp1 APN 13 100093438 missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100055308 splice site probably benign
IGL02415:Bdp1 APN 13 100089408 missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100098514 missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100078115 critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100051539 missense probably benign 0.29
IGL02738:Bdp1 APN 13 100051353 missense probably benign 0.26
IGL02754:Bdp1 APN 13 100060973 missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100042270 missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100055292 missense probably benign 0.00
IGL03156:Bdp1 APN 13 100061036 missense probably benign 0.44
IGL03166:Bdp1 APN 13 100035800 missense probably benign 0.28
IGL03232:Bdp1 APN 13 100051481 missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100023621 missense probably benign 0.02
R0115:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0481:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0619:Bdp1 UTSW 13 100037858 missense probably benign 0.00
R0730:Bdp1 UTSW 13 100058951 splice site probably benign
R0744:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R0833:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R1307:Bdp1 UTSW 13 100049763 missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100099008 missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100078755 nonsense probably null
R1644:Bdp1 UTSW 13 100060940 missense probably benign 0.03
R1670:Bdp1 UTSW 13 100027433 critical splice donor site probably null
R1836:Bdp1 UTSW 13 100035145 missense probably benign
R1869:Bdp1 UTSW 13 100042201 missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100098589 missense probably benign 0.30
R1944:Bdp1 UTSW 13 100074381 splice site probably null
R2030:Bdp1 UTSW 13 100061189 missense probably benign 0.00
R2069:Bdp1 UTSW 13 100050988 missense probably benign 0.00
R2180:Bdp1 UTSW 13 100061405 small insertion probably benign
R2263:Bdp1 UTSW 13 100066037 missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2277:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2278:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2336:Bdp1 UTSW 13 100053002 missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100060370 missense probably benign 0.08
R3154:Bdp1 UTSW 13 100049814 missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100059585 missense probably benign
R4322:Bdp1 UTSW 13 100092223 missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100056267 missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100049868 missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100051119 missense probably benign 0.26
R4917:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100030794 nonsense probably null
R5266:Bdp1 UTSW 13 100067535 missense probably benign 0.33
R5312:Bdp1 UTSW 13 100097601 splice site probably null
R5420:Bdp1 UTSW 13 100066043 missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100098510 missense probably damaging 1.00
R5909:Bdp1 UTSW 13 100092286 missense probably benign 0.08
R5913:Bdp1 UTSW 13 100051104 missense probably benign 0.41
R6018:Bdp1 UTSW 13 100038224 missense probably benign 0.00
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100025528 missense probably benign 0.00
R6969:Bdp1 UTSW 13 100074531 missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100037761 missense probably null 1.00
R6996:Bdp1 UTSW 13 100043813 missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100078707 missense probably benign 0.03
R7060:Bdp1 UTSW 13 100059494 missense probably damaging 1.00
R7105:Bdp1 UTSW 13 100070181 missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100061151 missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100041532 missense probably damaging 0.97
R7512:Bdp1 UTSW 13 100050949 missense probably benign 0.03
R7562:Bdp1 UTSW 13 100025541 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGTGGTCTACCTTATCAGTTAGAC -3'
(R):5'- AGTCATAGCTTTGTTCATGCACG -3'

Sequencing Primer
(F):5'- GGAAGTATCACTGTTTACCCAATAGG -3'
(R):5'- CATGCACGTTTCTGTACTTGTG -3'
Posted On2016-04-15