Incidental Mutation 'R0244:Ptprk'
ID37987
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 038482-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0244 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 28206225 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 63 (E63D)
Ref Sequence ENSEMBL: ENSMUSP00000126279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166468
AA Change: E63D

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: E63D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218276
AA Change: E63D

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218359
AA Change: E63D

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219761
Meta Mutation Damage Score 0.0572 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,491 probably null Het
Adamdec1 A T 14: 68,568,723 C434* probably null Het
Adprhl1 A G 8: 13,242,391 probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Arel1 T C 12: 84,920,693 T786A probably damaging Het
Arhgap26 A G 18: 39,363,131 K117R probably benign Het
Atp6v0b C T 4: 117,884,622 G204D probably damaging Het
Bace2 T A 16: 97,436,773 probably null Het
Camk4 G A 18: 33,179,625 probably null Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cep152 T C 2: 125,564,214 E1466G probably benign Het
Ces3b T C 8: 105,092,635 F441S probably damaging Het
Cfap52 T C 11: 67,926,382 T562A possibly damaging Het
Clca3a2 C A 3: 144,813,898 M238I possibly damaging Het
Cntnap5c A T 17: 58,102,168 D467V probably damaging Het
Col7a1 T A 9: 108,972,184 probably null Het
Cstf1 A G 2: 172,377,710 N247S possibly damaging Het
Dffb G T 4: 153,974,615 N68K probably benign Het
Duox2 C T 2: 122,291,860 G595S probably benign Het
Eftud2 T A 11: 102,864,725 I228F probably damaging Het
Elmo3 T C 8: 105,309,171 V578A probably benign Het
Elp2 A G 18: 24,631,471 D625G possibly damaging Het
Ep300 C T 15: 81,640,128 P1386S unknown Het
Fam120b A G 17: 15,417,637 D610G probably damaging Het
Fastk A T 5: 24,442,178 probably benign Het
Fbxl6 A G 15: 76,537,191 S252P probably damaging Het
Fbxo43 T C 15: 36,161,793 K423E probably damaging Het
Filip1 T A 9: 79,819,462 E625V possibly damaging Het
Fkbp9 T A 6: 56,856,378 Y283* probably null Het
Gigyf2 T A 1: 87,379,015 D142E possibly damaging Het
Gm10142 T C 10: 77,716,014 probably null Het
Golga5 T C 12: 102,476,188 V262A probably benign Het
Hectd4 T C 5: 121,329,605 V2539A probably benign Het
Ica1 G T 6: 8,653,632 S335* probably null Het
Itga1 A T 13: 115,006,897 probably benign Het
Itgb1 T C 8: 128,717,685 probably benign Het
Itpr1 G A 6: 108,473,589 V1960I probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kprp C T 3: 92,825,411 V111I probably benign Het
Lamc3 T C 2: 31,940,721 I1490T probably damaging Het
Lcp1 A T 14: 75,227,001 D554V possibly damaging Het
Lgi3 A G 14: 70,534,698 T228A probably benign Het
Lipa A T 19: 34,501,541 F260I probably damaging Het
Lrriq1 C T 10: 103,215,773 E373K probably damaging Het
Map6 G A 7: 99,336,836 G649D probably benign Het
Mccc1 A G 3: 35,990,047 probably null Het
Mical3 A T 6: 120,957,722 S1799T probably benign Het
Mmp23 T A 4: 155,652,132 T151S probably damaging Het
Myo1d T A 11: 80,674,708 N401I probably damaging Het
Myo9b T A 8: 71,321,813 S323T probably damaging Het
Nbn G T 4: 15,979,353 W446L probably benign Het
Nedd1 A T 10: 92,716,265 probably benign Het
Ngef C A 1: 87,487,962 probably benign Het
Nup153 A T 13: 46,693,936 N672K probably benign Het
Olfr1308 T C 2: 111,961,016 N19S probably benign Het
Olfr149 T A 9: 39,702,173 I199F probably damaging Het
Olfr1509 T C 14: 52,450,512 V33A probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Palm2 T G 4: 57,710,177 V374G possibly damaging Het
Pdlim3 C A 8: 45,908,460 probably benign Het
Pmfbp1 G A 8: 109,541,673 E951K probably damaging Het
Pop1 T A 15: 34,515,891 C548* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ptpdc1 A T 13: 48,585,980 N658K probably benign Het
Rtf1 C T 2: 119,732,877 R712W probably damaging Het
Samd7 A C 3: 30,751,073 T2P probably benign Het
Sft2d1 A G 17: 8,319,422 T52A probably benign Het
Slc25a26 A G 6: 94,510,833 H91R probably damaging Het
Slc5a4a A G 10: 76,189,152 E621G possibly damaging Het
Slf1 A T 13: 77,126,632 L28* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorcs2 G A 5: 36,397,553 probably benign Het
Tacc2 T C 7: 130,751,825 probably benign Het
Tas2r140 A G 6: 133,055,327 V156A possibly damaging Het
Terf2ip C A 8: 112,018,164 T371K possibly damaging Het
Tifa C T 3: 127,796,888 L103F probably damaging Het
Tmco3 A G 8: 13,292,037 N104D probably damaging Het
Tmem259 T A 10: 79,978,963 D240V probably damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Trps1 T C 15: 50,664,743 N725D probably damaging Het
Ttn C T 2: 76,814,806 V12902M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Unc79 A G 12: 103,112,891 K1772E probably damaging Het
Vwde C T 6: 13,193,126 V405I probably benign Het
Wdr18 T A 10: 79,966,408 D290E probably damaging Het
Wdr92 T C 11: 17,229,851 L284P probably damaging Het
Wwc2 G A 8: 47,900,721 A126V probably benign Het
Zfp882 A T 8: 71,913,523 I105F possibly damaging Het
Zfp942 A T 17: 21,928,572 C359S probably benign Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 unclassified probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGTCACCAGGTGCCATTTCC -3'
(R):5'- ACCAACAACTAGTGCTTGCTTAGAGTC -3'

Sequencing Primer
(F):5'- CAGGTGCCATTTCCCTCAG -3'
(R):5'- CCCTAGACATTGAATTAGGGGAA -3'
Posted On2013-05-23