Incidental Mutation 'R4915:Trrap'
ID379923
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Nametransformation/transcription domain-associated protein
Synonymstransactivation/transformation-domain associated protein
MMRRC Submission 042517-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4915 (G1)
Quality Score187
Status Validated
Chromosome5
Chromosomal Location144767732-144859778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144805735 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1101 (I1101F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
Predicted Effect probably benign
Transcript: ENSMUST00000038980
AA Change: I1387F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: I1387F

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094120
AA Change: I1387F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: I1387F

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100467
AA Change: I1387F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: I1387F

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132347
Predicted Effect probably damaging
Transcript: ENSMUST00000132925
AA Change: I1101F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: I1101F

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213013
AA Change: I1388F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency 98% (162/166)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 135 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,251,855 Y235* probably null Het
1700011H14Rik A T 14: 49,232,894 N189K probably benign Het
2700049A03Rik C T 12: 71,189,646 A1257V possibly damaging Het
Aldh8a1 T C 10: 21,395,763 S463P probably damaging Het
Angptl1 T G 1: 156,844,818 D71E probably benign Het
Ank2 T A 3: 126,942,671 probably benign Het
Ano1 A G 7: 144,611,375 S649P possibly damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Asb15 A T 6: 24,566,293 D415V probably damaging Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bmi1 G A 2: 18,682,332 probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Brd9 A G 13: 73,938,455 E25G probably damaging Het
Btbd7 A T 12: 102,837,787 C331* probably null Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cenpj T C 14: 56,553,718 D328G probably damaging Het
Cherp T C 8: 72,468,397 D255G probably damaging Het
Clec5a T A 6: 40,585,231 probably benign Het
Cntnap2 T C 6: 46,530,035 probably benign Het
Col7a1 G A 9: 108,966,464 G1529E unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2a22 C A 7: 26,937,770 E196D probably benign Het
Cyp4f18 T A 8: 72,009,054 H63L probably damaging Het
Dclk2 A T 3: 86,824,742 probably null Het
Ddx6 T A 9: 44,612,873 D82E probably damaging Het
Defb42 A G 14: 63,048,341 I57V probably benign Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Dip2c T A 13: 9,621,869 probably null Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dnah12 A T 14: 26,734,570 D816V probably damaging Het
Dpy19l3 T C 7: 35,752,742 probably benign Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Evl G T 12: 108,686,106 R359L probably damaging Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fbxw14 A T 9: 109,274,524 F40Y possibly damaging Het
Fbxw22 A G 9: 109,383,941 F313L probably damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fry A T 5: 150,478,863 T790S probably benign Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Gm13030 T A 4: 138,873,928 probably benign Het
Gm37150 C T 9: 72,385,490 noncoding transcript Het
Gm4450 C T 3: 98,450,529 V56M probably damaging Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gm8122 T C 14: 43,234,116 N65S unknown Het
Gnb4 C T 3: 32,585,087 probably benign Het
Gprin1 G T 13: 54,738,073 P796Q probably damaging Het
Grin1 A G 2: 25,298,553 probably benign Het
Helz2 T C 2: 181,232,438 R2088G possibly damaging Het
Ighv6-6 C A 12: 114,434,975 R57L probably damaging Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Iqgap3 T A 3: 88,101,527 I643K possibly damaging Het
Itga11 C A 9: 62,752,248 Y427* probably null Het
Kbtbd8 T G 6: 95,126,534 M388R possibly damaging Het
Kif1a T A 1: 93,074,978 E233V probably benign Het
Krt10 T C 11: 99,387,508 N275S probably damaging Het
Lrrc3 T C 10: 77,901,419 D61G probably benign Het
Mapk8ip3 A G 17: 24,909,153 S377P possibly damaging Het
Mccc1 A G 3: 35,997,554 L32S probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mmp11 C T 10: 75,925,585 A31T probably damaging Het
Mthfsl A C 9: 88,715,497 L67V probably damaging Het
Myo1c T G 11: 75,656,309 M1R probably null Het
N4bp2 T A 5: 65,803,504 M506K probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nid1 A G 13: 13,499,586 E850G possibly damaging Het
Nlrp9c T C 7: 26,384,460 T565A probably benign Het
Nomo1 T C 7: 46,044,232 F163L probably benign Het
Nsd1 T C 13: 55,247,868 V1197A possibly damaging Het
Nsd1 A G 13: 55,276,528 T1463A probably benign Het
Nsf G A 11: 103,910,359 probably benign Het
Olfr1010 T C 2: 85,754,121 probably benign Het
Olfr1080 A G 2: 86,554,055 L23P probably damaging Het
Olfr1301 A T 2: 111,754,380 I44F probably benign Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr262 A G 19: 12,241,373 V96A probably benign Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Pcdha6 T A 18: 36,968,457 D234E probably damaging Het
Pcnx C A 12: 81,974,495 F1425L probably benign Het
Pdzd9 T G 7: 120,670,168 N10T possibly damaging Het
Pex6 A T 17: 46,714,056 H345L probably damaging Het
Pfkfb3 G A 2: 11,490,298 Q100* probably null Het
Pgm1 G A 5: 64,100,948 G92E probably damaging Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Plcxd2 C T 16: 45,980,578 W94* probably null Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Prkcg T G 7: 3,330,265 Y624* probably null Het
Rabep2 T C 7: 126,444,922 S517P probably damaging Het
Rabgap1l A G 1: 160,441,842 I717T probably benign Het
Rasef A G 4: 73,731,459 C484R probably damaging Het
Rdh19 A G 10: 127,850,244 D75G probably benign Het
Rpl21-ps10 T C 3: 38,107,468 noncoding transcript Het
Rsl1d1 A T 16: 11,199,729 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rwdd1 T C 10: 34,009,078 D62G possibly damaging Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc24a1 A T 9: 64,947,931 F565I unknown Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Sox6 T C 7: 115,476,964 D814G probably damaging Het
Spata4 T C 8: 54,602,436 probably null Het
Spats2l A T 1: 57,902,188 K202M probably damaging Het
Speer4b C T 5: 27,500,136 E80K probably benign Het
Sqle T G 15: 59,321,369 Y198* probably null Het
Srek1 T C 13: 103,752,563 probably benign Het
Srek1 T C 13: 103,752,686 probably benign Het
St14 G A 9: 31,108,664 R50* probably null Het
Tcaf1 A G 6: 42,675,196 V784A probably damaging Het
Tfr2 C T 5: 137,583,411 R587W probably damaging Het
Tmpo A G 10: 91,149,549 V357A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttpal G A 2: 163,607,477 R84H probably damaging Het
Tyk2 T C 9: 21,111,137 T799A probably benign Het
Ugt1a10 A T 1: 88,055,924 D148V probably damaging Het
Usp29 C T 7: 6,961,505 P116S probably benign Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Het
Vmn1r90 T G 7: 14,562,025 R49S possibly damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Yars A T 4: 129,210,591 probably benign Het
Zfp114 T C 7: 24,177,865 L44P probably damaging Het
Zfp36l2 A G 17: 84,186,262 probably benign Het
Zfp512 T C 5: 31,476,865 S407P probably damaging Het
Zfp574 C T 7: 25,080,726 P391L probably damaging Het
Zfp607a T G 7: 27,878,560 C352G probably benign Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Zfr A C 15: 12,162,112 probably null Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144779974 splice site probably benign
IGL00470:Trrap APN 5 144818038 missense probably damaging 1.00
IGL00490:Trrap APN 5 144825225 missense probably benign 0.40
IGL01072:Trrap APN 5 144784255 splice site probably benign
IGL01087:Trrap APN 5 144846539 missense probably damaging 0.99
IGL01300:Trrap APN 5 144804818 missense probably damaging 1.00
IGL01350:Trrap APN 5 144830969 missense possibly damaging 0.92
IGL01410:Trrap APN 5 144831021 missense probably benign 0.00
IGL01571:Trrap APN 5 144833287 splice site probably benign
IGL01748:Trrap APN 5 144833340 missense probably damaging 1.00
IGL01839:Trrap APN 5 144821875 missense probably damaging 1.00
IGL01976:Trrap APN 5 144856989 missense probably benign 0.00
IGL02075:Trrap APN 5 144828494 missense probably benign 0.00
IGL02127:Trrap APN 5 144816433 missense probably benign 0.22
IGL02131:Trrap APN 5 144840436 missense probably damaging 1.00
IGL02287:Trrap APN 5 144832538 missense probably damaging 1.00
IGL02301:Trrap APN 5 144777917 missense probably benign 0.05
IGL02336:Trrap APN 5 144798390 missense probably benign 0.39
IGL02526:Trrap APN 5 144824550 missense probably benign 0.00
IGL02873:Trrap APN 5 144841079 splice site probably benign
IGL02953:Trrap APN 5 144815964 missense probably damaging 0.99
IGL03404:Trrap APN 5 144833186 missense probably benign 0.00
Card-tower UTSW 5 144804766 missense probably damaging 1.00
PIT4243001:Trrap UTSW 5 144796971 missense probably benign 0.00
PIT4466001:Trrap UTSW 5 144828600 missense probably benign 0.02
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0112:Trrap UTSW 5 144822761 nonsense probably null
R0126:Trrap UTSW 5 144805750 nonsense probably null
R0257:Trrap UTSW 5 144804235 missense probably benign 0.31
R0325:Trrap UTSW 5 144816395 missense probably benign 0.05
R0376:Trrap UTSW 5 144816339 missense probably benign 0.03
R0396:Trrap UTSW 5 144814556 missense probably damaging 0.99
R0448:Trrap UTSW 5 144839567 missense possibly damaging 0.66
R0454:Trrap UTSW 5 144846477 missense probably damaging 1.00
R0711:Trrap UTSW 5 144853499 missense probably damaging 1.00
R0827:Trrap UTSW 5 144814830 missense probably benign 0.00
R1005:Trrap UTSW 5 144805727 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1179:Trrap UTSW 5 144777939 missense possibly damaging 0.94
R1218:Trrap UTSW 5 144816409 missense probably damaging 1.00
R1264:Trrap UTSW 5 144789599 splice site probably benign
R1374:Trrap UTSW 5 144846618 missense probably damaging 1.00
R1401:Trrap UTSW 5 144857422 missense possibly damaging 0.93
R1480:Trrap UTSW 5 144818313 missense probably benign
R1538:Trrap UTSW 5 144837202 missense possibly damaging 0.65
R1751:Trrap UTSW 5 144814575 critical splice donor site probably null
R1779:Trrap UTSW 5 144828590 missense probably benign 0.01
R1782:Trrap UTSW 5 144822703 missense possibly damaging 0.93
R1792:Trrap UTSW 5 144853586 missense possibly damaging 0.87
R1859:Trrap UTSW 5 144830951 missense probably benign 0.04
R1861:Trrap UTSW 5 144815917 splice site probably null
R1902:Trrap UTSW 5 144816053 missense probably damaging 1.00
R1903:Trrap UTSW 5 144816053 missense probably damaging 1.00
R2021:Trrap UTSW 5 144853488 missense possibly damaging 0.94
R2026:Trrap UTSW 5 144803044 missense possibly damaging 0.86
R2036:Trrap UTSW 5 144828562 missense probably benign 0.08
R2099:Trrap UTSW 5 144782239 missense possibly damaging 0.46
R2108:Trrap UTSW 5 144825874 missense probably benign 0.01
R2113:Trrap UTSW 5 144844211 missense probably damaging 1.00
R2174:Trrap UTSW 5 144821855 missense probably benign 0.40
R2442:Trrap UTSW 5 144817966 missense probably damaging 1.00
R2568:Trrap UTSW 5 144843369 critical splice donor site probably null
R3442:Trrap UTSW 5 144792252 missense probably benign 0.03
R3853:Trrap UTSW 5 144792165 missense probably damaging 1.00
R4401:Trrap UTSW 5 144843318 missense possibly damaging 0.60
R4493:Trrap UTSW 5 144831048 missense probably benign 0.21
R4524:Trrap UTSW 5 144825321 missense probably benign 0.38
R4569:Trrap UTSW 5 144792118 missense probably benign 0.13
R4672:Trrap UTSW 5 144785480 missense probably damaging 0.97
R4732:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4733:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4791:Trrap UTSW 5 144803277 missense probably damaging 1.00
R4795:Trrap UTSW 5 144832488 missense probably benign 0.06
R4827:Trrap UTSW 5 144800948 missense probably benign 0.02
R4839:Trrap UTSW 5 144845592 missense probably damaging 1.00
R4951:Trrap UTSW 5 144805720 missense possibly damaging 0.65
R4959:Trrap UTSW 5 144856960 missense probably damaging 1.00
R5049:Trrap UTSW 5 144826717 missense probably damaging 1.00
R5074:Trrap UTSW 5 144851179 missense probably damaging 1.00
R5236:Trrap UTSW 5 144817786 missense probably benign 0.07
R5281:Trrap UTSW 5 144813503 missense probably benign 0.13
R5322:Trrap UTSW 5 144844224 missense probably damaging 1.00
R5457:Trrap UTSW 5 144849977 missense probably damaging 1.00
R5590:Trrap UTSW 5 144782265 missense probably benign 0.05
R5799:Trrap UTSW 5 144830945 missense probably benign
R5885:Trrap UTSW 5 144794793 missense probably damaging 1.00
R5905:Trrap UTSW 5 144849920 missense possibly damaging 0.95
R5908:Trrap UTSW 5 144786708 missense probably damaging 0.96
R5956:Trrap UTSW 5 144807391 splice site silent
R5992:Trrap UTSW 5 144810184 missense probably benign 0.00
R6017:Trrap UTSW 5 144844241 missense probably damaging 1.00
R6029:Trrap UTSW 5 144817679 missense possibly damaging 0.94
R6029:Trrap UTSW 5 144825914 missense possibly damaging 0.75
R6117:Trrap UTSW 5 144802961 missense possibly damaging 0.78
R6166:Trrap UTSW 5 144781981 missense possibly damaging 0.66
R6234:Trrap UTSW 5 144839713 intron probably null
R6288:Trrap UTSW 5 144811992 missense probably damaging 1.00
R6290:Trrap UTSW 5 144805018 missense probably damaging 1.00
R6316:Trrap UTSW 5 144813526 missense probably benign 0.02
R6398:Trrap UTSW 5 144790870 missense possibly damaging 0.83
R6413:Trrap UTSW 5 144784046 missense possibly damaging 0.83
R6499:Trrap UTSW 5 144857002 missense probably damaging 1.00
R6529:Trrap UTSW 5 144834204 missense probably benign 0.06
R6574:Trrap UTSW 5 144815550 critical splice donor site probably null
R6631:Trrap UTSW 5 144771650 missense possibly damaging 0.94
R6727:Trrap UTSW 5 144856950 missense probably damaging 1.00
R6776:Trrap UTSW 5 144851256 nonsense probably null
R6914:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6942:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6945:Trrap UTSW 5 144790855 missense possibly damaging 0.66
R7023:Trrap UTSW 5 144792154 missense possibly damaging 0.64
R7107:Trrap UTSW 5 144797135 missense probably benign 0.05
R7139:Trrap UTSW 5 144803178 missense possibly damaging 0.65
R7148:Trrap UTSW 5 144821803 missense possibly damaging 0.77
R7167:Trrap UTSW 5 144839614 missense probably benign 0.39
R7171:Trrap UTSW 5 144794049 missense probably damaging 1.00
R7205:Trrap UTSW 5 144842707 missense possibly damaging 0.94
R7215:Trrap UTSW 5 144797135 missense probably benign 0.05
R7255:Trrap UTSW 5 144858954 missense probably damaging 1.00
R7261:Trrap UTSW 5 144845477 missense possibly damaging 0.67
R7264:Trrap UTSW 5 144814523 missense probably benign 0.05
X0060:Trrap UTSW 5 144843361 missense probably damaging 0.96
Z1088:Trrap UTSW 5 144834197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCTTGAGGCAGCTAACAG -3'
(R):5'- AAAGGTCCCAGAGAGTGCTG -3'

Sequencing Primer
(F):5'- CTTGAGGCAGCTAACAGGAGGG -3'
(R):5'- TGTGTTTCCCGACTCAGTGTGAC -3'
Posted On2016-04-15