Incidental Mutation 'R4915:Cntnap2'
ID379928
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Namecontactin associated protein-like 2
Synonyms5430425M22Rik, Caspr2
MMRRC Submission 042517-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R4915 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location45059357-47304213 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 46530035 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
Predicted Effect probably benign
Transcript: ENSMUST00000114641
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182751
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency 98% (162/166)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 135 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,251,855 Y235* probably null Het
1700011H14Rik A T 14: 49,232,894 N189K probably benign Het
2700049A03Rik C T 12: 71,189,646 A1257V possibly damaging Het
Aldh8a1 T C 10: 21,395,763 S463P probably damaging Het
Angptl1 T G 1: 156,844,818 D71E probably benign Het
Ank2 T A 3: 126,942,671 probably benign Het
Ano1 A G 7: 144,611,375 S649P possibly damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Asb15 A T 6: 24,566,293 D415V probably damaging Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bmi1 G A 2: 18,682,332 probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Brd9 A G 13: 73,938,455 E25G probably damaging Het
Btbd7 A T 12: 102,837,787 C331* probably null Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cenpj T C 14: 56,553,718 D328G probably damaging Het
Cherp T C 8: 72,468,397 D255G probably damaging Het
Clec5a T A 6: 40,585,231 probably benign Het
Col7a1 G A 9: 108,966,464 G1529E unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2a22 C A 7: 26,937,770 E196D probably benign Het
Cyp4f18 T A 8: 72,009,054 H63L probably damaging Het
Dclk2 A T 3: 86,824,742 probably null Het
Ddx6 T A 9: 44,612,873 D82E probably damaging Het
Defb42 A G 14: 63,048,341 I57V probably benign Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Dip2c T A 13: 9,621,869 probably null Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dnah12 A T 14: 26,734,570 D816V probably damaging Het
Dpy19l3 T C 7: 35,752,742 probably benign Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Evl G T 12: 108,686,106 R359L probably damaging Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fbxw14 A T 9: 109,274,524 F40Y possibly damaging Het
Fbxw22 A G 9: 109,383,941 F313L probably damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fry A T 5: 150,478,863 T790S probably benign Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Gm13030 T A 4: 138,873,928 probably benign Het
Gm37150 C T 9: 72,385,490 noncoding transcript Het
Gm4450 C T 3: 98,450,529 V56M probably damaging Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gm8122 T C 14: 43,234,116 N65S unknown Het
Gnb4 C T 3: 32,585,087 probably benign Het
Gprin1 G T 13: 54,738,073 P796Q probably damaging Het
Grin1 A G 2: 25,298,553 probably benign Het
Helz2 T C 2: 181,232,438 R2088G possibly damaging Het
Ighv6-6 C A 12: 114,434,975 R57L probably damaging Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Iqgap3 T A 3: 88,101,527 I643K possibly damaging Het
Itga11 C A 9: 62,752,248 Y427* probably null Het
Kbtbd8 T G 6: 95,126,534 M388R possibly damaging Het
Kif1a T A 1: 93,074,978 E233V probably benign Het
Krt10 T C 11: 99,387,508 N275S probably damaging Het
Lrrc3 T C 10: 77,901,419 D61G probably benign Het
Mapk8ip3 A G 17: 24,909,153 S377P possibly damaging Het
Mccc1 A G 3: 35,997,554 L32S probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mmp11 C T 10: 75,925,585 A31T probably damaging Het
Mthfsl A C 9: 88,715,497 L67V probably damaging Het
Myo1c T G 11: 75,656,309 M1R probably null Het
N4bp2 T A 5: 65,803,504 M506K probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nid1 A G 13: 13,499,586 E850G possibly damaging Het
Nlrp9c T C 7: 26,384,460 T565A probably benign Het
Nomo1 T C 7: 46,044,232 F163L probably benign Het
Nsd1 T C 13: 55,247,868 V1197A possibly damaging Het
Nsd1 A G 13: 55,276,528 T1463A probably benign Het
Nsf G A 11: 103,910,359 probably benign Het
Olfr1010 T C 2: 85,754,121 probably benign Het
Olfr1080 A G 2: 86,554,055 L23P probably damaging Het
Olfr1301 A T 2: 111,754,380 I44F probably benign Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr262 A G 19: 12,241,373 V96A probably benign Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Pcdha6 T A 18: 36,968,457 D234E probably damaging Het
Pcnx C A 12: 81,974,495 F1425L probably benign Het
Pdzd9 T G 7: 120,670,168 N10T possibly damaging Het
Pex6 A T 17: 46,714,056 H345L probably damaging Het
Pfkfb3 G A 2: 11,490,298 Q100* probably null Het
Pgm1 G A 5: 64,100,948 G92E probably damaging Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Plcxd2 C T 16: 45,980,578 W94* probably null Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Prkcg T G 7: 3,330,265 Y624* probably null Het
Rabep2 T C 7: 126,444,922 S517P probably damaging Het
Rabgap1l A G 1: 160,441,842 I717T probably benign Het
Rasef A G 4: 73,731,459 C484R probably damaging Het
Rdh19 A G 10: 127,850,244 D75G probably benign Het
Rpl21-ps10 T C 3: 38,107,468 noncoding transcript Het
Rsl1d1 A T 16: 11,199,729 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rwdd1 T C 10: 34,009,078 D62G possibly damaging Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc24a1 A T 9: 64,947,931 F565I unknown Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Sox6 T C 7: 115,476,964 D814G probably damaging Het
Spata4 T C 8: 54,602,436 probably null Het
Spats2l A T 1: 57,902,188 K202M probably damaging Het
Speer4b C T 5: 27,500,136 E80K probably benign Het
Sqle T G 15: 59,321,369 Y198* probably null Het
Srek1 T C 13: 103,752,563 probably benign Het
Srek1 T C 13: 103,752,686 probably benign Het
St14 G A 9: 31,108,664 R50* probably null Het
Tcaf1 A G 6: 42,675,196 V784A probably damaging Het
Tfr2 C T 5: 137,583,411 R587W probably damaging Het
Tmpo A G 10: 91,149,549 V357A probably damaging Het
Trrap A T 5: 144,805,735 I1101F probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttpal G A 2: 163,607,477 R84H probably damaging Het
Tyk2 T C 9: 21,111,137 T799A probably benign Het
Ugt1a10 A T 1: 88,055,924 D148V probably damaging Het
Usp29 C T 7: 6,961,505 P116S probably benign Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Het
Vmn1r90 T G 7: 14,562,025 R49S possibly damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Yars A T 4: 129,210,591 probably benign Het
Zfp114 T C 7: 24,177,865 L44P probably damaging Het
Zfp36l2 A G 17: 84,186,262 probably benign Het
Zfp512 T C 5: 31,476,865 S407P probably damaging Het
Zfp574 C T 7: 25,080,726 P391L probably damaging Het
Zfp607a T G 7: 27,878,560 C352G probably benign Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Zfr A C 15: 12,162,112 probably null Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 utr 5 prime probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.27
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCCTCATAGAACGTGTATTCTGC -3'
(R):5'- TTTCCACGCCAGTTCACAAC -3'

Sequencing Primer
(F):5'- CTGTGCTAATGATTGTCCAGGAAGC -3'
(R):5'- CAGTGGGGAGCATTTTACATCCATC -3'
Posted On2016-04-15