Incidental Mutation 'R0244:Lrriq1'
ID37993
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
MMRRC Submission 038482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0244 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103215773 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 373 (E373K)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
Predicted Effect probably damaging
Transcript: ENSMUST00000020043
AA Change: E373K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: E373K

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123364
AA Change: E373K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: E373K

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166240
AA Change: E373K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: E373K

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220380
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,491 probably null Het
Adamdec1 A T 14: 68,568,723 C434* probably null Het
Adprhl1 A G 8: 13,242,391 probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Arel1 T C 12: 84,920,693 T786A probably damaging Het
Arhgap26 A G 18: 39,363,131 K117R probably benign Het
Atp6v0b C T 4: 117,884,622 G204D probably damaging Het
Bace2 T A 16: 97,436,773 probably null Het
Camk4 G A 18: 33,179,625 probably null Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cep152 T C 2: 125,564,214 E1466G probably benign Het
Ces3b T C 8: 105,092,635 F441S probably damaging Het
Cfap52 T C 11: 67,926,382 T562A possibly damaging Het
Clca3a2 C A 3: 144,813,898 M238I possibly damaging Het
Cntnap5c A T 17: 58,102,168 D467V probably damaging Het
Col7a1 T A 9: 108,972,184 probably null Het
Cstf1 A G 2: 172,377,710 N247S possibly damaging Het
Dffb G T 4: 153,974,615 N68K probably benign Het
Duox2 C T 2: 122,291,860 G595S probably benign Het
Eftud2 T A 11: 102,864,725 I228F probably damaging Het
Elmo3 T C 8: 105,309,171 V578A probably benign Het
Elp2 A G 18: 24,631,471 D625G possibly damaging Het
Ep300 C T 15: 81,640,128 P1386S unknown Het
Fam120b A G 17: 15,417,637 D610G probably damaging Het
Fastk A T 5: 24,442,178 probably benign Het
Fbxl6 A G 15: 76,537,191 S252P probably damaging Het
Fbxo43 T C 15: 36,161,793 K423E probably damaging Het
Filip1 T A 9: 79,819,462 E625V possibly damaging Het
Fkbp9 T A 6: 56,856,378 Y283* probably null Het
Gigyf2 T A 1: 87,379,015 D142E possibly damaging Het
Gm10142 T C 10: 77,716,014 probably null Het
Golga5 T C 12: 102,476,188 V262A probably benign Het
Hectd4 T C 5: 121,329,605 V2539A probably benign Het
Ica1 G T 6: 8,653,632 S335* probably null Het
Itga1 A T 13: 115,006,897 probably benign Het
Itgb1 T C 8: 128,717,685 probably benign Het
Itpr1 G A 6: 108,473,589 V1960I probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kprp C T 3: 92,825,411 V111I probably benign Het
Lamc3 T C 2: 31,940,721 I1490T probably damaging Het
Lcp1 A T 14: 75,227,001 D554V possibly damaging Het
Lgi3 A G 14: 70,534,698 T228A probably benign Het
Lipa A T 19: 34,501,541 F260I probably damaging Het
Map6 G A 7: 99,336,836 G649D probably benign Het
Mccc1 A G 3: 35,990,047 probably null Het
Mical3 A T 6: 120,957,722 S1799T probably benign Het
Mmp23 T A 4: 155,652,132 T151S probably damaging Het
Myo1d T A 11: 80,674,708 N401I probably damaging Het
Myo9b T A 8: 71,321,813 S323T probably damaging Het
Nbn G T 4: 15,979,353 W446L probably benign Het
Nedd1 A T 10: 92,716,265 probably benign Het
Ngef C A 1: 87,487,962 probably benign Het
Nup153 A T 13: 46,693,936 N672K probably benign Het
Olfr1308 T C 2: 111,961,016 N19S probably benign Het
Olfr149 T A 9: 39,702,173 I199F probably damaging Het
Olfr1509 T C 14: 52,450,512 V33A probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Palm2 T G 4: 57,710,177 V374G possibly damaging Het
Pdlim3 C A 8: 45,908,460 probably benign Het
Pmfbp1 G A 8: 109,541,673 E951K probably damaging Het
Pop1 T A 15: 34,515,891 C548* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ptpdc1 A T 13: 48,585,980 N658K probably benign Het
Ptprk A C 10: 28,206,225 E63D possibly damaging Het
Rtf1 C T 2: 119,732,877 R712W probably damaging Het
Samd7 A C 3: 30,751,073 T2P probably benign Het
Sft2d1 A G 17: 8,319,422 T52A probably benign Het
Slc25a26 A G 6: 94,510,833 H91R probably damaging Het
Slc5a4a A G 10: 76,189,152 E621G possibly damaging Het
Slf1 A T 13: 77,126,632 L28* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorcs2 G A 5: 36,397,553 probably benign Het
Tacc2 T C 7: 130,751,825 probably benign Het
Tas2r140 A G 6: 133,055,327 V156A possibly damaging Het
Terf2ip C A 8: 112,018,164 T371K possibly damaging Het
Tifa C T 3: 127,796,888 L103F probably damaging Het
Tmco3 A G 8: 13,292,037 N104D probably damaging Het
Tmem259 T A 10: 79,978,963 D240V probably damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Trps1 T C 15: 50,664,743 N725D probably damaging Het
Ttn C T 2: 76,814,806 V12902M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Unc79 A G 12: 103,112,891 K1772E probably damaging Het
Vwde C T 6: 13,193,126 V405I probably benign Het
Wdr18 T A 10: 79,966,408 D290E probably damaging Het
Wdr92 T C 11: 17,229,851 L284P probably damaging Het
Wwc2 G A 8: 47,900,721 A126V probably benign Het
Zfp882 A T 8: 71,913,523 I105F possibly damaging Het
Zfp942 A T 17: 21,928,572 C359S probably benign Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAATAGCTTGCTGCTTGCC -3'
(R):5'- AGAGCACTTTCACCCGTCATTTAGG -3'

Sequencing Primer
(F):5'- TAATGATCAGTGGCGAGTGG -3'
(R):5'- GGCACGTTTATTCAAACTGCG -3'
Posted On2013-05-23