Incidental Mutation 'R4915:Col7a1'
ID379961
Institutional Source Beutler Lab
Gene Symbol Col7a1
Ensembl Gene ENSMUSG00000025650
Gene Namecollagen, type VII, alpha 1
Synonyms
MMRRC Submission 042517-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4915 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108953586-108984875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108966464 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 1529 (G1529E)
Ref Sequence ENSEMBL: ENSMUSP00000107701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026740] [ENSMUST00000112070]
Predicted Effect unknown
Transcript: ENSMUST00000026740
AA Change: G1529E
SMART Domains Protein: ENSMUSP00000026740
Gene: ENSMUSG00000025650
AA Change: G1529E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1227 2.3e-22 PFAM
Pfam:Collagen 1244 1311 2.4e-8 PFAM
Pfam:Collagen 1294 1355 4.1e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.8e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.4e-9 PFAM
Pfam:Collagen 2025 2092 9.1e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.5e-8 PFAM
Pfam:Collagen 2364 2423 7.3e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.4e-11 PFAM
Pfam:Collagen 2516 2572 1.9e-9 PFAM
Pfam:Collagen 2560 2630 7.2e-9 PFAM
Pfam:Collagen 2605 2682 6e-9 PFAM
Pfam:Collagen 2659 2722 2e-8 PFAM
low complexity region 2745 2775 N/A INTRINSIC
Pfam:Kunitz_BPTI 2878 2932 3.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102188
Predicted Effect unknown
Transcript: ENSMUST00000112070
AA Change: G1529E
SMART Domains Protein: ENSMUSP00000107701
Gene: ENSMUSG00000025650
AA Change: G1529E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1230 2.2e-19 PFAM
Pfam:Collagen 1244 1311 2.5e-8 PFAM
Pfam:Collagen 1294 1355 4.2e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5.1e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.9e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.5e-9 PFAM
Pfam:Collagen 2025 2092 9.4e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2195 2266 7.7e-7 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.6e-8 PFAM
Pfam:Collagen 2364 2423 7.6e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.7e-11 PFAM
Pfam:Collagen 2516 2572 2e-9 PFAM
Pfam:Collagen 2560 2630 7.4e-9 PFAM
Pfam:Collagen 2605 2682 6.2e-9 PFAM
Pfam:Collagen 2659 2722 2.1e-8 PFAM
Pfam:Collagen 2719 2778 1.6e-7 PFAM
Pfam:Kunitz_BPTI 2878 2932 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127905
Meta Mutation Damage Score 0.444 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency 98% (162/166)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 135 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,251,855 Y235* probably null Het
1700011H14Rik A T 14: 49,232,894 N189K probably benign Het
2700049A03Rik C T 12: 71,189,646 A1257V possibly damaging Het
Aldh8a1 T C 10: 21,395,763 S463P probably damaging Het
Angptl1 T G 1: 156,844,818 D71E probably benign Het
Ank2 T A 3: 126,942,671 probably benign Het
Ano1 A G 7: 144,611,375 S649P possibly damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Asb15 A T 6: 24,566,293 D415V probably damaging Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bmi1 G A 2: 18,682,332 probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Brd9 A G 13: 73,938,455 E25G probably damaging Het
Btbd7 A T 12: 102,837,787 C331* probably null Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cenpj T C 14: 56,553,718 D328G probably damaging Het
Cherp T C 8: 72,468,397 D255G probably damaging Het
Clec5a T A 6: 40,585,231 probably benign Het
Cntnap2 T C 6: 46,530,035 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2a22 C A 7: 26,937,770 E196D probably benign Het
Cyp4f18 T A 8: 72,009,054 H63L probably damaging Het
Dclk2 A T 3: 86,824,742 probably null Het
Ddx6 T A 9: 44,612,873 D82E probably damaging Het
Defb42 A G 14: 63,048,341 I57V probably benign Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Dip2c T A 13: 9,621,869 probably null Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dnah12 A T 14: 26,734,570 D816V probably damaging Het
Dpy19l3 T C 7: 35,752,742 probably benign Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Evl G T 12: 108,686,106 R359L probably damaging Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fbxw14 A T 9: 109,274,524 F40Y possibly damaging Het
Fbxw22 A G 9: 109,383,941 F313L probably damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fry A T 5: 150,478,863 T790S probably benign Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Gm13030 T A 4: 138,873,928 probably benign Het
Gm37150 C T 9: 72,385,490 noncoding transcript Het
Gm4450 C T 3: 98,450,529 V56M probably damaging Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gm8122 T C 14: 43,234,116 N65S unknown Het
Gnb4 C T 3: 32,585,087 probably benign Het
Gprin1 G T 13: 54,738,073 P796Q probably damaging Het
Grin1 A G 2: 25,298,553 probably benign Het
Helz2 T C 2: 181,232,438 R2088G possibly damaging Het
Ighv6-6 C A 12: 114,434,975 R57L probably damaging Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Iqgap3 T A 3: 88,101,527 I643K possibly damaging Het
Itga11 C A 9: 62,752,248 Y427* probably null Het
Kbtbd8 T G 6: 95,126,534 M388R possibly damaging Het
Kif1a T A 1: 93,074,978 E233V probably benign Het
Krt10 T C 11: 99,387,508 N275S probably damaging Het
Lrrc3 T C 10: 77,901,419 D61G probably benign Het
Mapk8ip3 A G 17: 24,909,153 S377P possibly damaging Het
Mccc1 A G 3: 35,997,554 L32S probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mmp11 C T 10: 75,925,585 A31T probably damaging Het
Mthfsl A C 9: 88,715,497 L67V probably damaging Het
Myo1c T G 11: 75,656,309 M1R probably null Het
N4bp2 T A 5: 65,803,504 M506K probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nid1 A G 13: 13,499,586 E850G possibly damaging Het
Nlrp9c T C 7: 26,384,460 T565A probably benign Het
Nomo1 T C 7: 46,044,232 F163L probably benign Het
Nsd1 T C 13: 55,247,868 V1197A possibly damaging Het
Nsd1 A G 13: 55,276,528 T1463A probably benign Het
Nsf G A 11: 103,910,359 probably benign Het
Olfr1010 T C 2: 85,754,121 probably benign Het
Olfr1080 A G 2: 86,554,055 L23P probably damaging Het
Olfr1301 A T 2: 111,754,380 I44F probably benign Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr262 A G 19: 12,241,373 V96A probably benign Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Pcdha6 T A 18: 36,968,457 D234E probably damaging Het
Pcnx C A 12: 81,974,495 F1425L probably benign Het
Pdzd9 T G 7: 120,670,168 N10T possibly damaging Het
Pex6 A T 17: 46,714,056 H345L probably damaging Het
Pfkfb3 G A 2: 11,490,298 Q100* probably null Het
Pgm1 G A 5: 64,100,948 G92E probably damaging Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Plcxd2 C T 16: 45,980,578 W94* probably null Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Prkcg T G 7: 3,330,265 Y624* probably null Het
Rabep2 T C 7: 126,444,922 S517P probably damaging Het
Rabgap1l A G 1: 160,441,842 I717T probably benign Het
Rasef A G 4: 73,731,459 C484R probably damaging Het
Rdh19 A G 10: 127,850,244 D75G probably benign Het
Rpl21-ps10 T C 3: 38,107,468 noncoding transcript Het
Rsl1d1 A T 16: 11,199,729 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rwdd1 T C 10: 34,009,078 D62G possibly damaging Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc24a1 A T 9: 64,947,931 F565I unknown Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Sox6 T C 7: 115,476,964 D814G probably damaging Het
Spata4 T C 8: 54,602,436 probably null Het
Spats2l A T 1: 57,902,188 K202M probably damaging Het
Speer4b C T 5: 27,500,136 E80K probably benign Het
Sqle T G 15: 59,321,369 Y198* probably null Het
Srek1 T C 13: 103,752,563 probably benign Het
Srek1 T C 13: 103,752,686 probably benign Het
St14 G A 9: 31,108,664 R50* probably null Het
Tcaf1 A G 6: 42,675,196 V784A probably damaging Het
Tfr2 C T 5: 137,583,411 R587W probably damaging Het
Tmpo A G 10: 91,149,549 V357A probably damaging Het
Trrap A T 5: 144,805,735 I1101F probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttpal G A 2: 163,607,477 R84H probably damaging Het
Tyk2 T C 9: 21,111,137 T799A probably benign Het
Ugt1a10 A T 1: 88,055,924 D148V probably damaging Het
Usp29 C T 7: 6,961,505 P116S probably benign Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Het
Vmn1r90 T G 7: 14,562,025 R49S possibly damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Yars A T 4: 129,210,591 probably benign Het
Zfp114 T C 7: 24,177,865 L44P probably damaging Het
Zfp36l2 A G 17: 84,186,262 probably benign Het
Zfp512 T C 5: 31,476,865 S407P probably damaging Het
Zfp574 C T 7: 25,080,726 P391L probably damaging Het
Zfp607a T G 7: 27,878,560 C352G probably benign Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Zfr A C 15: 12,162,112 probably null Het
Other mutations in Col7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Col7a1 APN 9 108977697 nonsense probably null
IGL01366:Col7a1 APN 9 108977119 splice site probably benign
IGL01395:Col7a1 APN 9 108983912 unclassified probably benign
IGL01410:Col7a1 APN 9 108964618 missense unknown
IGL01902:Col7a1 APN 9 108977827 missense unknown
IGL01915:Col7a1 APN 9 108955745 missense unknown
IGL01936:Col7a1 APN 9 108967999 splice site probably benign
IGL01943:Col7a1 APN 9 108984016 critical splice acceptor site probably null
IGL02026:Col7a1 APN 9 108968029 missense probably damaging 1.00
IGL02168:Col7a1 APN 9 108984075 unclassified probably benign
IGL02504:Col7a1 APN 9 108980675 missense unknown
IGL02510:Col7a1 APN 9 108973231 splice site probably benign
IGL02559:Col7a1 APN 9 108973216 missense unknown
IGL02583:Col7a1 APN 9 108962229 missense unknown
IGL02728:Col7a1 APN 9 108984104 missense probably benign 0.39
IGL03003:Col7a1 APN 9 108974956 critical splice donor site probably null
IGL03096:Col7a1 APN 9 108955788 missense unknown
IGL03122:Col7a1 APN 9 108961683 missense unknown
IGL03212:Col7a1 APN 9 108974452 missense unknown
IGL03240:Col7a1 APN 9 108968373 missense probably null 1.00
IGL03355:Col7a1 APN 9 108978160 missense unknown
smallified UTSW 9 108972813 critical splice donor site probably null
underwood UTSW 9 108968875 critical splice acceptor site probably null
PIT4131001:Col7a1 UTSW 9 108965921 splice site probably benign
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0078:Col7a1 UTSW 9 108974913 splice site probably benign
R0091:Col7a1 UTSW 9 108967506 splice site probably benign
R0126:Col7a1 UTSW 9 108969583 splice site probably benign
R0244:Col7a1 UTSW 9 108972184 splice site probably null
R0331:Col7a1 UTSW 9 108967502 splice site probably benign
R0375:Col7a1 UTSW 9 108980237 missense unknown
R0601:Col7a1 UTSW 9 108980584 splice site probably benign
R0609:Col7a1 UTSW 9 108958147 missense unknown
R0709:Col7a1 UTSW 9 108961548 splice site probably benign
R0879:Col7a1 UTSW 9 108976091 splice site probably benign
R1175:Col7a1 UTSW 9 108955334 missense unknown
R1177:Col7a1 UTSW 9 108962441 missense unknown
R1435:Col7a1 UTSW 9 108963273 missense unknown
R1497:Col7a1 UTSW 9 108978825 missense unknown
R1549:Col7a1 UTSW 9 108955966 missense unknown
R1794:Col7a1 UTSW 9 108965928 missense unknown
R1801:Col7a1 UTSW 9 108960997 missense unknown
R1848:Col7a1 UTSW 9 108969565 missense possibly damaging 0.83
R1899:Col7a1 UTSW 9 108978888 missense unknown
R1944:Col7a1 UTSW 9 108960010 missense unknown
R1945:Col7a1 UTSW 9 108960010 missense unknown
R1955:Col7a1 UTSW 9 108955664 missense unknown
R2009:Col7a1 UTSW 9 108968875 critical splice acceptor site probably null
R2034:Col7a1 UTSW 9 108963007 missense unknown
R3148:Col7a1 UTSW 9 108961405 missense unknown
R3713:Col7a1 UTSW 9 108964440 nonsense probably null
R4078:Col7a1 UTSW 9 108960991 missense unknown
R4193:Col7a1 UTSW 9 108956672 missense unknown
R4232:Col7a1 UTSW 9 108972813 critical splice donor site probably null
R4528:Col7a1 UTSW 9 108959533 missense unknown
R4771:Col7a1 UTSW 9 108971925 missense probably damaging 0.99
R4820:Col7a1 UTSW 9 108968607 missense possibly damaging 0.72
R4896:Col7a1 UTSW 9 108957277 missense unknown
R4911:Col7a1 UTSW 9 108975219 missense unknown
R4917:Col7a1 UTSW 9 108966464 missense unknown
R5001:Col7a1 UTSW 9 108965078 critical splice donor site probably null
R5352:Col7a1 UTSW 9 108961411 missense unknown
R5361:Col7a1 UTSW 9 108963224 missense unknown
R5730:Col7a1 UTSW 9 108972242 critical splice donor site probably null
R5838:Col7a1 UTSW 9 108978143 missense unknown
R5842:Col7a1 UTSW 9 108965815 missense unknown
R5932:Col7a1 UTSW 9 108980211 missense unknown
R6091:Col7a1 UTSW 9 108955334 missense unknown
R6144:Col7a1 UTSW 9 108974080 missense unknown
R6158:Col7a1 UTSW 9 108964603 missense unknown
R6170:Col7a1 UTSW 9 108966443 missense unknown
R6247:Col7a1 UTSW 9 108981062 unclassified probably benign
R6338:Col7a1 UTSW 9 108956633 missense unknown
R6339:Col7a1 UTSW 9 108956633 missense unknown
R6382:Col7a1 UTSW 9 108975393 missense unknown
R6518:Col7a1 UTSW 9 108955527 missense unknown
R6533:Col7a1 UTSW 9 108961358 missense unknown
R6569:Col7a1 UTSW 9 108978110 splice site probably null
R6596:Col7a1 UTSW 9 108954341 unclassified probably benign
R6697:Col7a1 UTSW 9 108970533 missense probably damaging 1.00
R6753:Col7a1 UTSW 9 108958128 missense unknown
R6849:Col7a1 UTSW 9 108975053 missense unknown
R6915:Col7a1 UTSW 9 108967618 missense probably benign 0.02
R6974:Col7a1 UTSW 9 108969426 missense possibly damaging 0.82
R6991:Col7a1 UTSW 9 108983919 critical splice donor site probably null
R7028:Col7a1 UTSW 9 108963263 nonsense probably null
X0023:Col7a1 UTSW 9 108984185 unclassified probably benign
Z1088:Col7a1 UTSW 9 108978500 splice site silent
Predicted Primers PCR Primer
(F):5'- TGGGACCCCTTTCTAACCTG -3'
(R):5'- TGTTGGATCAGGACCCCATC -3'

Sequencing Primer
(F):5'- ACCAATGTTTCTCTTCCCCAGGG -3'
(R):5'- GGACCCCATCTGTCCCTCAC -3'
Posted On2016-04-15