Incidental Mutation 'R4915:Tmpo'
ID379969
Institutional Source Beutler Lab
Gene Symbol Tmpo
Ensembl Gene ENSMUSG00000019961
Gene Namethymopoietin
Synonymslamina-associated polypeptide 2, TP, LAP2, 5630400D24Rik
MMRRC Submission 042517-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4915 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location91147571-91181315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91149549 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 357 (V357A)
Ref Sequence ENSEMBL: ENSMUSP00000096956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072239] [ENSMUST00000092219] [ENSMUST00000099355] [ENSMUST00000105293]
Predicted Effect probably damaging
Transcript: ENSMUST00000072239
AA Change: V429A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072092
Gene: ENSMUSG00000019961
AA Change: V429A

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
low complexity region 226 240 N/A INTRINSIC
transmembrane domain 410 429 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092219
AA Change: V389A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089864
Gene: ENSMUSG00000019961
AA Change: V389A

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099355
AA Change: V357A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096956
Gene: ENSMUSG00000019961
AA Change: V357A

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105293
AA Change: V320A

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100930
Gene: ENSMUSG00000019961
AA Change: V320A

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 301 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217449
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency 98% (162/166)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous null for a protein isoform generated from this locus have hyperproliferation of epidermal and erythroid progenitor cells that leads to thickened paws and increased crypt lengths in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 135 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,251,855 Y235* probably null Het
1700011H14Rik A T 14: 49,232,894 N189K probably benign Het
2700049A03Rik C T 12: 71,189,646 A1257V possibly damaging Het
Aldh8a1 T C 10: 21,395,763 S463P probably damaging Het
Angptl1 T G 1: 156,844,818 D71E probably benign Het
Ank2 T A 3: 126,942,671 probably benign Het
Ano1 A G 7: 144,611,375 S649P possibly damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Asb15 A T 6: 24,566,293 D415V probably damaging Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bmi1 G A 2: 18,682,332 probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Brd9 A G 13: 73,938,455 E25G probably damaging Het
Btbd7 A T 12: 102,837,787 C331* probably null Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cenpj T C 14: 56,553,718 D328G probably damaging Het
Cherp T C 8: 72,468,397 D255G probably damaging Het
Clec5a T A 6: 40,585,231 probably benign Het
Cntnap2 T C 6: 46,530,035 probably benign Het
Col7a1 G A 9: 108,966,464 G1529E unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2a22 C A 7: 26,937,770 E196D probably benign Het
Cyp4f18 T A 8: 72,009,054 H63L probably damaging Het
Dclk2 A T 3: 86,824,742 probably null Het
Ddx6 T A 9: 44,612,873 D82E probably damaging Het
Defb42 A G 14: 63,048,341 I57V probably benign Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Dip2c T A 13: 9,621,869 probably null Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dnah12 A T 14: 26,734,570 D816V probably damaging Het
Dpy19l3 T C 7: 35,752,742 probably benign Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Evl G T 12: 108,686,106 R359L probably damaging Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fbxw14 A T 9: 109,274,524 F40Y possibly damaging Het
Fbxw22 A G 9: 109,383,941 F313L probably damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fry A T 5: 150,478,863 T790S probably benign Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Gm13030 T A 4: 138,873,928 probably benign Het
Gm37150 C T 9: 72,385,490 noncoding transcript Het
Gm4450 C T 3: 98,450,529 V56M probably damaging Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gm8122 T C 14: 43,234,116 N65S unknown Het
Gnb4 C T 3: 32,585,087 probably benign Het
Gprin1 G T 13: 54,738,073 P796Q probably damaging Het
Grin1 A G 2: 25,298,553 probably benign Het
Helz2 T C 2: 181,232,438 R2088G possibly damaging Het
Ighv6-6 C A 12: 114,434,975 R57L probably damaging Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Iqgap3 T A 3: 88,101,527 I643K possibly damaging Het
Itga11 C A 9: 62,752,248 Y427* probably null Het
Kbtbd8 T G 6: 95,126,534 M388R possibly damaging Het
Kif1a T A 1: 93,074,978 E233V probably benign Het
Krt10 T C 11: 99,387,508 N275S probably damaging Het
Lrrc3 T C 10: 77,901,419 D61G probably benign Het
Mapk8ip3 A G 17: 24,909,153 S377P possibly damaging Het
Mccc1 A G 3: 35,997,554 L32S probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mmp11 C T 10: 75,925,585 A31T probably damaging Het
Mthfsl A C 9: 88,715,497 L67V probably damaging Het
Myo1c T G 11: 75,656,309 M1R probably null Het
N4bp2 T A 5: 65,803,504 M506K probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nid1 A G 13: 13,499,586 E850G possibly damaging Het
Nlrp9c T C 7: 26,384,460 T565A probably benign Het
Nomo1 T C 7: 46,044,232 F163L probably benign Het
Nsd1 T C 13: 55,247,868 V1197A possibly damaging Het
Nsd1 A G 13: 55,276,528 T1463A probably benign Het
Nsf G A 11: 103,910,359 probably benign Het
Olfr1010 T C 2: 85,754,121 probably benign Het
Olfr1080 A G 2: 86,554,055 L23P probably damaging Het
Olfr1301 A T 2: 111,754,380 I44F probably benign Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr262 A G 19: 12,241,373 V96A probably benign Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Pcdha6 T A 18: 36,968,457 D234E probably damaging Het
Pcnx C A 12: 81,974,495 F1425L probably benign Het
Pdzd9 T G 7: 120,670,168 N10T possibly damaging Het
Pex6 A T 17: 46,714,056 H345L probably damaging Het
Pfkfb3 G A 2: 11,490,298 Q100* probably null Het
Pgm1 G A 5: 64,100,948 G92E probably damaging Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Plcxd2 C T 16: 45,980,578 W94* probably null Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Prkcg T G 7: 3,330,265 Y624* probably null Het
Rabep2 T C 7: 126,444,922 S517P probably damaging Het
Rabgap1l A G 1: 160,441,842 I717T probably benign Het
Rasef A G 4: 73,731,459 C484R probably damaging Het
Rdh19 A G 10: 127,850,244 D75G probably benign Het
Rpl21-ps10 T C 3: 38,107,468 noncoding transcript Het
Rsl1d1 A T 16: 11,199,729 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rwdd1 T C 10: 34,009,078 D62G possibly damaging Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc24a1 A T 9: 64,947,931 F565I unknown Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Sox6 T C 7: 115,476,964 D814G probably damaging Het
Spata4 T C 8: 54,602,436 probably null Het
Spats2l A T 1: 57,902,188 K202M probably damaging Het
Speer4b C T 5: 27,500,136 E80K probably benign Het
Sqle T G 15: 59,321,369 Y198* probably null Het
Srek1 T C 13: 103,752,563 probably benign Het
Srek1 T C 13: 103,752,686 probably benign Het
St14 G A 9: 31,108,664 R50* probably null Het
Tcaf1 A G 6: 42,675,196 V784A probably damaging Het
Tfr2 C T 5: 137,583,411 R587W probably damaging Het
Trrap A T 5: 144,805,735 I1101F probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttpal G A 2: 163,607,477 R84H probably damaging Het
Tyk2 T C 9: 21,111,137 T799A probably benign Het
Ugt1a10 A T 1: 88,055,924 D148V probably damaging Het
Usp29 C T 7: 6,961,505 P116S probably benign Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Het
Vmn1r90 T G 7: 14,562,025 R49S possibly damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Yars A T 4: 129,210,591 probably benign Het
Zfp114 T C 7: 24,177,865 L44P probably damaging Het
Zfp36l2 A G 17: 84,186,262 probably benign Het
Zfp512 T C 5: 31,476,865 S407P probably damaging Het
Zfp574 C T 7: 25,080,726 P391L probably damaging Het
Zfp607a T G 7: 27,878,560 C352G probably benign Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Zfr A C 15: 12,162,112 probably null Het
Other mutations in Tmpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Tmpo APN 10 91164206 splice site probably benign
IGL00791:Tmpo APN 10 91162558 missense possibly damaging 0.94
IGL00919:Tmpo APN 10 91162800 missense probably damaging 0.99
IGL01382:Tmpo APN 10 91166050 missense probably damaging 1.00
IGL01806:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01813:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01838:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01952:Tmpo APN 10 91163242 missense probably benign 0.01
IGL02110:Tmpo APN 10 91162865 missense probably damaging 1.00
IGL02122:Tmpo APN 10 91164136 missense possibly damaging 0.77
IGL02191:Tmpo APN 10 91161879 missense probably benign 0.00
IGL02338:Tmpo APN 10 91163242 missense probably benign 0.01
R0133:Tmpo UTSW 10 91164038 splice site probably benign
R0450:Tmpo UTSW 10 91163096 missense probably benign 0.45
R0469:Tmpo UTSW 10 91163096 missense probably benign 0.45
R0836:Tmpo UTSW 10 91161953 nonsense probably null
R2405:Tmpo UTSW 10 91163354 missense probably damaging 1.00
R2919:Tmpo UTSW 10 91152686 missense probably benign 0.23
R4059:Tmpo UTSW 10 91162261 missense probably benign 0.00
R4296:Tmpo UTSW 10 91162956 missense possibly damaging 0.49
R4741:Tmpo UTSW 10 91162644 missense probably benign 0.18
R4881:Tmpo UTSW 10 91162641 missense possibly damaging 0.93
R4917:Tmpo UTSW 10 91149549 missense probably damaging 1.00
R4960:Tmpo UTSW 10 91153309 missense probably damaging 1.00
R5002:Tmpo UTSW 10 91164114 missense possibly damaging 0.76
R5301:Tmpo UTSW 10 91149788 intron probably benign
R6167:Tmpo UTSW 10 91162938 missense probably benign
R6190:Tmpo UTSW 10 91164207 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGCTTTTCAATGCAGCACTAAC -3'
(R):5'- ACCAATCAAAGGTGCTGCAGG -3'

Sequencing Primer
(F):5'- GCAGCACTAACTTTACTGAGGTG -3'
(R):5'- CCTTGGCAGATGTCAAGT -3'
Posted On2016-04-15