Incidental Mutation 'R4916:Kmt2b'
ID380064
Institutional Source Beutler Lab
Gene Symbol Kmt2b
Ensembl Gene ENSMUSG00000006307
Gene Namelysine (K)-specific methyltransferase 2B
Synonyms2610014H22Rik, Wbp7, Mll2
MMRRC Submission 042518-MU
Accession Numbers

Genbank: NM_029274; MGI: 109565

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4916 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30568858-30588726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30578517 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1634 (N1634S)
Ref Sequence ENSEMBL: ENSMUSP00000103789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108154]
Predicted Effect probably damaging
Transcript: ENSMUST00000006470
AA Change: N1634S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307
AA Change: N1634S

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108154
AA Change: N1634S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307
AA Change: N1634S

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128456
Predicted Effect unknown
Transcript: ENSMUST00000131002
AA Change: N925S
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307
AA Change: N925S

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152931
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]
Allele List at MGI

 All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595D18Rik G A 12: 111,174,935 Q19* probably null Het
5430419D17Rik T A 7: 131,174,477 probably null Het
6030468B19Rik T A 11: 117,806,266 C230* probably null Het
A730017C20Rik A T 18: 59,072,205 I22F probably damaging Het
Adcy10 A G 1: 165,518,246 E288G probably damaging Het
Adnp T A 2: 168,187,617 T51S possibly damaging Het
Agap3 C A 5: 24,478,013 A464D probably damaging Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Ahi1 A G 10: 20,984,404 R675G probably damaging Het
Amigo1 T A 3: 108,187,665 L160Q probably damaging Het
Ankrd35 T C 3: 96,684,122 S575P probably benign Het
Ano3 T A 2: 110,771,020 T298S possibly damaging Het
Ap2b1 T G 11: 83,390,706 F813V probably damaging Het
Aplnr T G 2: 85,136,917 F95L probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Ascc1 A G 10: 60,004,862 N15S probably benign Het
AY358078 T A 14: 51,802,651 Y73N unknown Het
B3gnt8 C A 7: 25,628,883 P246Q probably damaging Het
C2cd2l T C 9: 44,316,560 Q250R probably damaging Het
Camk2d T C 3: 126,783,975 Y180H probably damaging Het
Ccdc129 C T 6: 55,978,190 P928S possibly damaging Het
Ccdc170 A G 10: 4,518,971 E167G probably damaging Het
Cdyl2 A G 8: 116,579,187 M445T probably damaging Het
Clca1 T C 3: 145,015,844 D322G probably benign Het
Cnot10 C T 9: 114,629,134 M101I possibly damaging Het
Cntrl C T 2: 35,165,682 T1196M probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcaf6 T C 1: 165,420,205 D153G probably damaging Het
Dennd2c G A 3: 103,131,824 G96E probably benign Het
Dhrs9 T C 2: 69,401,408 F304S probably damaging Het
Dmxl1 T C 18: 49,877,697 S974P probably damaging Het
Dnah6 T C 6: 73,192,676 probably benign Het
Dnah7c T C 1: 46,595,008 L1049P probably damaging Het
Dnajc2 T C 5: 21,757,340 K621E probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erap1 A G 13: 74,646,528 E102G probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxl20 T C 11: 98,128,360 D22G probably damaging Het
Fgfr1 T C 8: 25,563,526 probably null Het
Frzb A T 2: 80,446,527 I105N probably damaging Het
Gabrb1 T A 5: 71,869,421 F55Y probably damaging Het
Gatd1 G T 7: 141,409,097 C216* probably null Het
Gnl2 A C 4: 125,043,692 N255T probably damaging Het
Golgb1 A T 16: 36,916,118 Q1909L probably benign Het
Gpnmb T C 6: 49,051,970 L474P probably damaging Het
H60b T C 10: 22,287,216 V230A possibly damaging Het
Hmcn2 T A 2: 31,360,980 V818D probably damaging Het
Jade2 G T 11: 51,817,082 T768K probably benign Het
Kif28 T C 1: 179,702,520 H692R probably benign Het
Knop1 A G 7: 118,846,076 W222R probably damaging Het
Lrmp C A 6: 145,165,301 S277R probably damaging Het
Map1b T C 13: 99,433,300 D971G unknown Het
Mapk7 G T 11: 61,493,649 T77K probably damaging Het
Mcm6 A G 1: 128,348,977 L292P probably damaging Het
Megf8 T C 7: 25,339,664 L900P probably benign Het
Meis1 G A 11: 18,881,776 H421Y possibly damaging Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mta1 T A 12: 113,136,540 S657T probably benign Het
Mtus1 C A 8: 41,000,801 K998N probably damaging Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Ndufb7 T C 8: 83,570,905 L63P probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nos1 T C 5: 117,947,570 probably null Het
Nrp1 C A 8: 128,502,804 S921* probably null Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Oma1 T C 4: 103,319,530 probably null Het
Pcp2 T A 8: 3,625,534 probably benign Het
Pdk4 T A 6: 5,489,157 H250L possibly damaging Het
Phldb3 A G 7: 24,624,291 H449R probably benign Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prkcg T G 7: 3,330,265 Y624* probably null Het
Psmg2 A G 18: 67,648,856 E164G probably damaging Het
Rb1 A T 14: 73,216,691 L589H probably damaging Het
Rcvrn A T 11: 67,695,765 I117F probably damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Robo2 A G 16: 73,898,915 S1447P possibly damaging Het
Scfd2 C A 5: 74,462,658 G405W probably damaging Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Serpina3k G A 12: 104,343,010 V238M probably damaging Het
Slc1a6 G A 10: 78,796,251 V304M probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc31a2 T C 4: 62,297,088 V124A probably damaging Het
Slc38a3 T C 9: 107,656,227 N244S probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slc6a5 T C 7: 49,948,256 F623L probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Slfn8 G A 11: 83,016,878 H280Y probably damaging Het
Smpdl3a A T 10: 57,801,031 D45V probably damaging Het
Ssh3 T C 19: 4,265,142 E342G probably damaging Het
Tacr1 A T 6: 82,554,941 I273F probably benign Het
Tfg T A 16: 56,694,396 probably null Het
Tmem179 A G 12: 112,501,834 L71P probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Traj20 G A 14: 54,199,467 probably benign Het
Trappc13 A T 13: 104,154,294 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tulp1 A G 17: 28,359,135 L310P probably damaging Het
Ube2cbp A G 9: 86,422,872 Y306H probably damaging Het
Urb1 A T 16: 90,783,328 V649E probably damaging Het
Vps13d A G 4: 144,983,393 L4211P probably damaging Het
Vwa5b1 T A 4: 138,594,262 I407F possibly damaging Het
Vwce G T 19: 10,646,879 C378F probably damaging Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Kmt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Kmt2b APN 7 30586513 unclassified probably benign
IGL00821:Kmt2b APN 7 30570613 missense probably damaging 1.00
IGL00985:Kmt2b APN 7 30579927 missense probably damaging 1.00
IGL01092:Kmt2b APN 7 30580507 missense probably damaging 1.00
IGL01933:Kmt2b APN 7 30569514 critical splice donor site probably null
IGL01949:Kmt2b APN 7 30577161 splice site probably null
IGL02253:Kmt2b APN 7 30581727 missense probably damaging 1.00
IGL02455:Kmt2b APN 7 30578878 critical splice donor site probably null
IGL02493:Kmt2b APN 7 30569511 unclassified probably benign
IGL02504:Kmt2b APN 7 30586543 unclassified probably benign
IGL02532:Kmt2b APN 7 30586889 unclassified probably benign
IGL02698:Kmt2b APN 7 30578693 splice site probably benign
IGL02717:Kmt2b APN 7 30583444 missense probably damaging 1.00
IGL02826:Kmt2b APN 7 30577144 missense probably damaging 1.00
IGL02966:Kmt2b APN 7 30575462 missense probably benign 0.02
IGL03386:Kmt2b APN 7 30573971 missense possibly damaging 0.94
3-1:Kmt2b UTSW 7 30569615 nonsense probably null
FR4304:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4342:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4548:Kmt2b UTSW 7 30586380 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586364 nonsense probably null
FR4589:Kmt2b UTSW 7 30586381 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586367 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586370 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586378 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586360 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586362 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586364 nonsense probably null
FR4976:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586373 unclassified probably benign
R0057:Kmt2b UTSW 7 30576792 splice site probably benign
R0131:Kmt2b UTSW 7 30583921 missense probably damaging 0.99
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0377:Kmt2b UTSW 7 30574193 missense probably damaging 1.00
R0396:Kmt2b UTSW 7 30576755 missense probably damaging 1.00
R1241:Kmt2b UTSW 7 30574940 missense probably damaging 0.98
R1252:Kmt2b UTSW 7 30580487 missense probably damaging 0.99
R1418:Kmt2b UTSW 7 30576960 splice site probably benign
R1599:Kmt2b UTSW 7 30570575 missense probably damaging 1.00
R1632:Kmt2b UTSW 7 30583962 missense probably damaging 1.00
R1745:Kmt2b UTSW 7 30585850 missense possibly damaging 0.90
R1867:Kmt2b UTSW 7 30574658 missense possibly damaging 0.71
R1955:Kmt2b UTSW 7 30575351 missense possibly damaging 0.90
R2040:Kmt2b UTSW 7 30569420 missense probably damaging 1.00
R2113:Kmt2b UTSW 7 30583387 missense probably damaging 1.00
R2216:Kmt2b UTSW 7 30574065 missense probably benign 0.25
R2401:Kmt2b UTSW 7 30576708 missense probably damaging 1.00
R2518:Kmt2b UTSW 7 30576068 missense probably benign 0.10
R3436:Kmt2b UTSW 7 30576692 missense probably damaging 1.00
R4248:Kmt2b UTSW 7 30574064 missense probably benign 0.25
R4259:Kmt2b UTSW 7 30581081 missense probably damaging 0.99
R4290:Kmt2b UTSW 7 30581836 critical splice donor site probably null
R4388:Kmt2b UTSW 7 30588590 unclassified probably benign
R4542:Kmt2b UTSW 7 30580259 missense probably damaging 0.99
R4649:Kmt2b UTSW 7 30586358 unclassified probably benign
R4722:Kmt2b UTSW 7 30583202 missense probably damaging 1.00
R4891:Kmt2b UTSW 7 30576761 nonsense probably null
R5104:Kmt2b UTSW 7 30569840 missense probably damaging 1.00
R5254:Kmt2b UTSW 7 30569175 missense probably damaging 1.00
R5262:Kmt2b UTSW 7 30569794 missense probably damaging 1.00
R5307:Kmt2b UTSW 7 30581673 missense possibly damaging 0.91
R5526:Kmt2b UTSW 7 30580444 missense probably damaging 1.00
R5609:Kmt2b UTSW 7 30577145 missense probably damaging 0.99
R6150:Kmt2b UTSW 7 30588477 unclassified probably benign
R6727:Kmt2b UTSW 7 30584559 missense probably damaging 0.98
R6824:Kmt2b UTSW 7 30586276 unclassified probably benign
R7048:Kmt2b UTSW 7 30569306 missense probably damaging 0.99
X0067:Kmt2b UTSW 7 30579573 missense probably damaging 0.99
Z1088:Kmt2b UTSW 7 30585251 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACCAAGGGAGCCAGATTCAG -3'
(R):5'- GCAGAGCTCTAGGTTGTGGG -3'

Sequencing Primer
(F):5'- AGCACTTGCCTAGCATATGTGAG -3'
(R):5'- CTAGGTTGTGGGGTCCAGTCC -3'
Posted On2016-04-15