Incidental Mutation 'R4916:Tulp1'
ID380124
Institutional Source Beutler Lab
Gene Symbol Tulp1
Ensembl Gene ENSMUSG00000037446
Gene Nametubby like protein 1
SynonymsTulp1l
MMRRC Submission 042518-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R4916 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28351515-28365182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28359135 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 310 (L310P)
Ref Sequence ENSEMBL: ENSMUSP00000110442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041819] [ENSMUST00000114794] [ENSMUST00000123797] [ENSMUST00000129375]
Predicted Effect probably damaging
Transcript: ENSMUST00000041819
AA Change: L310P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049070
Gene: ENSMUSG00000037446
AA Change: L310P

DomainStartEndE-ValueType
internal_repeat_1 17 65 8.47e-7 PROSPERO
low complexity region 111 142 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
internal_repeat_1 160 212 8.47e-7 PROSPERO
coiled coil region 242 266 N/A INTRINSIC
Pfam:Tub 299 537 1.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114794
AA Change: L310P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110442
Gene: ENSMUSG00000037446
AA Change: L310P

DomainStartEndE-ValueType
internal_repeat_1 17 65 8.5e-7 PROSPERO
low complexity region 111 142 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
internal_repeat_1 160 212 8.5e-7 PROSPERO
coiled coil region 242 266 N/A INTRINSIC
Pfam:Tub 299 449 3.4e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123797
AA Change: L32P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116588
Gene: ENSMUSG00000037446
AA Change: L32P

DomainStartEndE-ValueType
Pfam:Tub 21 228 2.1e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125876
Predicted Effect probably benign
Transcript: ENSMUST00000129375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146493
Predicted Effect probably benign
Transcript: ENSMUST00000148188
SMART Domains Protein: ENSMUSP00000116844
Gene: ENSMUSG00000037446

DomainStartEndE-ValueType
Pfam:Tub 5 214 8.8e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150341
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubby-like gene family (TULPs). Members of this family have been identified in plants, vertebrates, and invertebrates. TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. The protein encoded by this gene is thought to play a role in the physiology of photoreceptors. Mutations in this gene are associated with recessive juvenile retinitis pigmentosa and Leber congenital amaurosis-15. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutant mice exhibit retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595D18Rik G A 12: 111,174,935 Q19* probably null Het
5430419D17Rik T A 7: 131,174,477 probably null Het
6030468B19Rik T A 11: 117,806,266 C230* probably null Het
A730017C20Rik A T 18: 59,072,205 I22F probably damaging Het
Adcy10 A G 1: 165,518,246 E288G probably damaging Het
Adnp T A 2: 168,187,617 T51S possibly damaging Het
Agap3 C A 5: 24,478,013 A464D probably damaging Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Ahi1 A G 10: 20,984,404 R675G probably damaging Het
Amigo1 T A 3: 108,187,665 L160Q probably damaging Het
Ankrd35 T C 3: 96,684,122 S575P probably benign Het
Ano3 T A 2: 110,771,020 T298S possibly damaging Het
Ap2b1 T G 11: 83,390,706 F813V probably damaging Het
Aplnr T G 2: 85,136,917 F95L probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Ascc1 A G 10: 60,004,862 N15S probably benign Het
AY358078 T A 14: 51,802,651 Y73N unknown Het
B3gnt8 C A 7: 25,628,883 P246Q probably damaging Het
C2cd2l T C 9: 44,316,560 Q250R probably damaging Het
Camk2d T C 3: 126,783,975 Y180H probably damaging Het
Ccdc129 C T 6: 55,978,190 P928S possibly damaging Het
Ccdc170 A G 10: 4,518,971 E167G probably damaging Het
Cdyl2 A G 8: 116,579,187 M445T probably damaging Het
Clca1 T C 3: 145,015,844 D322G probably benign Het
Cnot10 C T 9: 114,629,134 M101I possibly damaging Het
Cntrl C T 2: 35,165,682 T1196M probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcaf6 T C 1: 165,420,205 D153G probably damaging Het
Dennd2c G A 3: 103,131,824 G96E probably benign Het
Dhrs9 T C 2: 69,401,408 F304S probably damaging Het
Dmxl1 T C 18: 49,877,697 S974P probably damaging Het
Dnah6 T C 6: 73,192,676 probably benign Het
Dnah7c T C 1: 46,595,008 L1049P probably damaging Het
Dnajc2 T C 5: 21,757,340 K621E probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erap1 A G 13: 74,646,528 E102G probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxl20 T C 11: 98,128,360 D22G probably damaging Het
Fgfr1 T C 8: 25,563,526 probably null Het
Frzb A T 2: 80,446,527 I105N probably damaging Het
Gabrb1 T A 5: 71,869,421 F55Y probably damaging Het
Gatd1 G T 7: 141,409,097 C216* probably null Het
Gnl2 A C 4: 125,043,692 N255T probably damaging Het
Golgb1 A T 16: 36,916,118 Q1909L probably benign Het
Gpnmb T C 6: 49,051,970 L474P probably damaging Het
H60b T C 10: 22,287,216 V230A possibly damaging Het
Hmcn2 T A 2: 31,360,980 V818D probably damaging Het
Jade2 G T 11: 51,817,082 T768K probably benign Het
Kif28 T C 1: 179,702,520 H692R probably benign Het
Kmt2b T C 7: 30,578,517 N1634S probably damaging Het
Knop1 A G 7: 118,846,076 W222R probably damaging Het
Lrmp C A 6: 145,165,301 S277R probably damaging Het
Map1b T C 13: 99,433,300 D971G unknown Het
Mapk7 G T 11: 61,493,649 T77K probably damaging Het
Mcm6 A G 1: 128,348,977 L292P probably damaging Het
Megf8 T C 7: 25,339,664 L900P probably benign Het
Meis1 G A 11: 18,881,776 H421Y possibly damaging Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mta1 T A 12: 113,136,540 S657T probably benign Het
Mtus1 C A 8: 41,000,801 K998N probably damaging Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Ndufb7 T C 8: 83,570,905 L63P probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nos1 T C 5: 117,947,570 probably null Het
Nrp1 C A 8: 128,502,804 S921* probably null Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Oma1 T C 4: 103,319,530 probably null Het
Pcp2 T A 8: 3,625,534 probably benign Het
Pdk4 T A 6: 5,489,157 H250L possibly damaging Het
Phldb3 A G 7: 24,624,291 H449R probably benign Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prkcg T G 7: 3,330,265 Y624* probably null Het
Psmg2 A G 18: 67,648,856 E164G probably damaging Het
Rb1 A T 14: 73,216,691 L589H probably damaging Het
Rcvrn A T 11: 67,695,765 I117F probably damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Robo2 A G 16: 73,898,915 S1447P possibly damaging Het
Scfd2 C A 5: 74,462,658 G405W probably damaging Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Serpina3k G A 12: 104,343,010 V238M probably damaging Het
Slc1a6 G A 10: 78,796,251 V304M probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc31a2 T C 4: 62,297,088 V124A probably damaging Het
Slc38a3 T C 9: 107,656,227 N244S probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slc6a5 T C 7: 49,948,256 F623L probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Slfn8 G A 11: 83,016,878 H280Y probably damaging Het
Smpdl3a A T 10: 57,801,031 D45V probably damaging Het
Ssh3 T C 19: 4,265,142 E342G probably damaging Het
Tacr1 A T 6: 82,554,941 I273F probably benign Het
Tfg T A 16: 56,694,396 probably null Het
Tmem179 A G 12: 112,501,834 L71P probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Traj20 G A 14: 54,199,467 probably benign Het
Trappc13 A T 13: 104,154,294 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ube2cbp A G 9: 86,422,872 Y306H probably damaging Het
Urb1 A T 16: 90,783,328 V649E probably damaging Het
Vps13d A G 4: 144,983,393 L4211P probably damaging Het
Vwa5b1 T A 4: 138,594,262 I407F possibly damaging Het
Vwce G T 19: 10,646,879 C378F probably damaging Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Tulp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Tulp1 APN 17 28356424 missense probably damaging 1.00
IGL01955:Tulp1 APN 17 28356424 missense probably damaging 1.00
IGL02388:Tulp1 APN 17 28358659 missense probably damaging 1.00
IGL02511:Tulp1 APN 17 28356168 missense probably benign 0.15
IGL02973:Tulp1 APN 17 28358542 splice site probably benign
IGL03054:Tulp1 APN 17 28359313 unclassified probably benign
IGL03248:Tulp1 APN 17 28359324 missense possibly damaging 0.87
R1017:Tulp1 UTSW 17 28364303 missense probably damaging 1.00
R1543:Tulp1 UTSW 17 28362671 unclassified probably benign
R1593:Tulp1 UTSW 17 28362701 missense probably damaging 0.97
R1826:Tulp1 UTSW 17 28356367 missense possibly damaging 0.89
R2323:Tulp1 UTSW 17 28362482 missense probably damaging 1.00
R3840:Tulp1 UTSW 17 28353715 missense probably damaging 1.00
R3841:Tulp1 UTSW 17 28353715 missense probably damaging 1.00
R3930:Tulp1 UTSW 17 28353709 missense probably damaging 1.00
R4690:Tulp1 UTSW 17 28351837 unclassified probably benign
R4823:Tulp1 UTSW 17 28353572 missense probably benign 0.01
R5024:Tulp1 UTSW 17 28351995 nonsense probably null
R5159:Tulp1 UTSW 17 28359060 critical splice donor site probably null
R5249:Tulp1 UTSW 17 28362677 unclassified probably benign
R5567:Tulp1 UTSW 17 28359198 missense possibly damaging 0.47
R6072:Tulp1 UTSW 17 28363784 missense possibly damaging 0.71
R6127:Tulp1 UTSW 17 28356150 missense probably benign
R6207:Tulp1 UTSW 17 28358677 unclassified probably benign
R6416:Tulp1 UTSW 17 28356031 makesense probably null
R6773:Tulp1 UTSW 17 28362902 missense probably damaging 1.00
R7242:Tulp1 UTSW 17 28363405 intron probably null
R7323:Tulp1 UTSW 17 28356424 missense probably damaging 1.00
R7542:Tulp1 UTSW 17 28363755 missense not run
X0024:Tulp1 UTSW 17 28353697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACCACCCTCAGTCCTAG -3'
(R):5'- AGCTCTTTTCTCCCTCCAGAAA -3'

Sequencing Primer
(F):5'- TCAGTCCTAGACACCGCC -3'
(R):5'- AAAGTGGTAAGTGGTGGCCTGTC -3'
Posted On2016-04-15