Incidental Mutation 'R4935:Prkab2'
ID380286
Institutional Source Beutler Lab
Gene Symbol Prkab2
Ensembl Gene ENSMUSG00000038205
Gene Nameprotein kinase, AMP-activated, beta 2 non-catalytic subunit
Synonyms5730553K21Rik
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location97658193-97673812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97662355 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 79 (V79A)
Ref Sequence ENSEMBL: ENSMUSP00000036410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045743] [ENSMUST00000130924] [ENSMUST00000143927]
Predicted Effect probably damaging
Transcript: ENSMUST00000045743
AA Change: V79A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036410
Gene: ENSMUSG00000038205
AA Change: V79A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:AMPK1_CBM 76 160 1.1e-38 PFAM
AMPKBI 181 271 6.31e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130924
SMART Domains Protein: ENSMUSP00000116622
Gene: ENSMUSG00000038205

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132719
Predicted Effect probably damaging
Transcript: ENSMUST00000143927
AA Change: V79A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115749
Gene: ENSMUSG00000038205
AA Change: V79A

DomainStartEndE-ValueType
PDB:4CFF|D 1 176 1e-68 PDB
Blast:AMPKBI 91 176 6e-50 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152731
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit may be a positive regulator of AMPK activity. It is highly expressed in skeletal muscle and thus may have tissue-specific roles. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased exercise endurance, muscle force, muscle and liver glycogen, and skeletal muscle fiber size and increased susceptibility to diet induced obesity and hyperinsulinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Prkab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Prkab2 APN 3 97662343 missense possibly damaging 0.95
R0255:Prkab2 UTSW 3 97667412 nonsense probably null
R0377:Prkab2 UTSW 3 97662317 missense probably benign
R1500:Prkab2 UTSW 3 97663947 missense probably damaging 1.00
R1952:Prkab2 UTSW 3 97666627 missense probably benign 0.00
R2114:Prkab2 UTSW 3 97667395 missense possibly damaging 0.49
R2437:Prkab2 UTSW 3 97667399 missense probably damaging 1.00
R5085:Prkab2 UTSW 3 97672992 unclassified probably benign
R5566:Prkab2 UTSW 3 97662293 missense probably benign 0.21
R6186:Prkab2 UTSW 3 97663991 splice site probably null
R7477:Prkab2 UTSW 3 97658747 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGTTGACGCCTAATTTAATGCCC -3'
(R):5'- CTTGAGAAGCAGAGTCCCGAAG -3'

Sequencing Primer
(F):5'- TGCCCATTAAAAACCTTTGGGAC -3'
(R):5'- AATGCTGTCAGAAGCTCCTG -3'
Posted On2016-04-15