Incidental Mutation 'R4935:Abcb1a'
ID380294
Institutional Source Beutler Lab
Gene Symbol Abcb1a
Ensembl Gene ENSMUSG00000040584
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 1A
SynonymsPgp, mdr-3, Pgy-3, MDR3, P-glycoprotein, Evi32, P-gp, Mdr1a, Pgy3, multiple drug resistant 1a
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8660077-8748575 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 8737773 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047753]
PDB Structure
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structure of Mouse P-Glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-RRR [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-SSS [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably null
Transcript: ENSMUST00000047753
SMART Domains Protein: ENSMUSP00000041204
Gene: ENSMUSG00000040584

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 339 8.3e-97 PFAM
AAA 415 607 1.22e-20 SMART
Pfam:ABC_membrane 707 982 4.8e-79 PFAM
AAA 1058 1246 8.85e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199172
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a p-glycoprotein which actively transports a variety of hydrophobic amphipathic drugs and plays a major role in the blood-brain barrier permeability of certain drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in increased sensitivity to various drugs, including avermectins and vinblastine. Mice with a null allele develop spontanous colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Abcb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Abcb1a APN 5 8686257 missense probably benign 0.01
IGL00898:Abcb1a APN 5 8733690 missense probably damaging 0.97
IGL01064:Abcb1a APN 5 8732388 missense possibly damaging 0.65
IGL01118:Abcb1a APN 5 8674687 missense probably damaging 1.00
IGL01150:Abcb1a APN 5 8702550 missense possibly damaging 0.90
IGL01584:Abcb1a APN 5 8698637 missense possibly damaging 0.95
IGL01654:Abcb1a APN 5 8715065 critical splice donor site probably null
IGL01820:Abcb1a APN 5 8715896 splice site probably benign
IGL02499:Abcb1a APN 5 8726807 missense possibly damaging 0.67
IGL02711:Abcb1a APN 5 8723245 splice site probably null
IGL02954:Abcb1a APN 5 8732341 missense probably benign 0.00
IGL03018:Abcb1a APN 5 8702451 missense probably damaging 0.99
IGL03119:Abcb1a APN 5 8714887 missense probably benign 0.00
IGL03292:Abcb1a APN 5 8715827 missense possibly damaging 0.93
IGL03338:Abcb1a APN 5 8694153 missense probably damaging 1.00
R0418:Abcb1a UTSW 5 8713281 missense probably damaging 0.96
R0559:Abcb1a UTSW 5 8698535 missense probably benign 0.01
R0595:Abcb1a UTSW 5 8740417 missense probably damaging 1.00
R0599:Abcb1a UTSW 5 8698539 missense probably benign 0.13
R0811:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0812:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0894:Abcb1a UTSW 5 8674856 splice site probably benign
R0948:Abcb1a UTSW 5 8740621 splice site probably null
R1292:Abcb1a UTSW 5 8713343 missense probably benign 0.00
R1318:Abcb1a UTSW 5 8701621 missense probably benign 0.31
R1459:Abcb1a UTSW 5 8702920 missense probably damaging 1.00
R1489:Abcb1a UTSW 5 8686300 critical splice donor site probably null
R1514:Abcb1a UTSW 5 8674791 missense possibly damaging 0.88
R2100:Abcb1a UTSW 5 8713202 missense probably damaging 1.00
R2409:Abcb1a UTSW 5 8738747 missense probably benign 0.30
R2844:Abcb1a UTSW 5 8686164 missense probably benign 0.02
R3709:Abcb1a UTSW 5 8738738 missense probably benign 0.03
R3755:Abcb1a UTSW 5 8747403 missense possibly damaging 0.95
R4193:Abcb1a UTSW 5 8715068 splice site probably null
R4401:Abcb1a UTSW 5 8702390 missense possibly damaging 0.54
R4463:Abcb1a UTSW 5 8719981 splice site probably benign
R4539:Abcb1a UTSW 5 8715793 missense probably benign
R4635:Abcb1a UTSW 5 8714927 missense probably benign
R4740:Abcb1a UTSW 5 8702280 critical splice donor site probably null
R4757:Abcb1a UTSW 5 8737632 missense probably damaging 0.99
R4764:Abcb1a UTSW 5 8715732 splice site probably null
R4792:Abcb1a UTSW 5 8746657 critical splice donor site probably null
R4829:Abcb1a UTSW 5 8723214 missense probably damaging 1.00
R5140:Abcb1a UTSW 5 8702154 missense probably damaging 0.99
R5181:Abcb1a UTSW 5 8714937 missense probably benign
R5355:Abcb1a UTSW 5 8726873 missense probably damaging 1.00
R5406:Abcb1a UTSW 5 8702946 missense probably damaging 0.99
R5496:Abcb1a UTSW 5 8674818 missense probably benign
R5557:Abcb1a UTSW 5 8714949 missense probably benign 0.01
R5572:Abcb1a UTSW 5 8715108 intron probably null
R5702:Abcb1a UTSW 5 8737752 missense probably benign 0.15
R5753:Abcb1a UTSW 5 8723160 missense probably damaging 0.98
R5769:Abcb1a UTSW 5 8683426 missense probably benign 0.01
R5895:Abcb1a UTSW 5 8702216 missense probably damaging 1.00
R6536:Abcb1a UTSW 5 8719030 missense probably benign 0.01
R6555:Abcb1a UTSW 5 8702468 missense probably damaging 0.97
R6798:Abcb1a UTSW 5 8732364 missense probably damaging 1.00
R6875:Abcb1a UTSW 5 8701628 missense probably benign 0.28
R7000:Abcb1a UTSW 5 8702823 missense probably benign 0.19
R7102:Abcb1a UTSW 5 8694072 missense probably benign 0.01
R7172:Abcb1a UTSW 5 8702399 missense probably benign 0.00
R7313:Abcb1a UTSW 5 8723187 missense probably damaging 1.00
R7513:Abcb1a UTSW 5 8715771 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCACATTGTTAACGTTGTAGC -3'
(R):5'- GTCAATAGTCATATCTCCCTGTAACTG -3'

Sequencing Primer
(F):5'- ACGTTGTAGCTATCACACACTG -3'
(R):5'- TCTCCCTGTAACTGTTTTATGAAAG -3'
Posted On2016-04-15