Incidental Mutation 'R4935:Tbxas1'
ID380299
Institutional Source Beutler Lab
Gene Symbol Tbxas1
Ensembl Gene ENSMUSG00000029925
Gene Namethromboxane A synthase 1, platelet
SynonymsTXAS, TXS, CYP5A1, CYP5
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location38875404-39084585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39023047 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 256 (N256I)
Ref Sequence ENSEMBL: ENSMUSP00000003017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003017]
Predicted Effect probably benign
Transcript: ENSMUST00000003017
AA Change: N256I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000003017
Gene: ENSMUSG00000029925
AA Change: N256I

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
Pfam:p450 44 530 1.5e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161781
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to thromboxane A2, a potent vasoconstrictor and inducer of platelet aggregation. The enzyme plays a role in several pathophysiological processes including hemostasis, cardiovascular disease, and stroke. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display increased bleeding time and decreased platelet response to arachidonic acid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Tbxas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Tbxas1 APN 6 39021181 missense probably damaging 0.97
IGL01319:Tbxas1 APN 6 39017973 missense probably benign 0.09
IGL01633:Tbxas1 APN 6 38982191 missense probably benign 0.00
IGL01712:Tbxas1 APN 6 39081060 missense probably benign 0.00
IGL01860:Tbxas1 APN 6 38948627 missense probably damaging 1.00
IGL01964:Tbxas1 APN 6 39083814 missense probably benign 0.00
IGL02036:Tbxas1 APN 6 39021157 missense probably benign
IGL02335:Tbxas1 APN 6 39023080 missense probably damaging 1.00
IGL02615:Tbxas1 APN 6 39027866 missense probably damaging 1.00
R0245:Tbxas1 UTSW 6 39027768 missense probably benign 0.00
R1677:Tbxas1 UTSW 6 39017888 splice site probably benign
R1975:Tbxas1 UTSW 6 38948641 splice site probably benign
R1977:Tbxas1 UTSW 6 38948641 splice site probably benign
R2308:Tbxas1 UTSW 6 39027661 missense probably benign 0.08
R4394:Tbxas1 UTSW 6 39027779 missense probably benign 0.19
R4702:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4703:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4705:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R5424:Tbxas1 UTSW 6 39027905 missense possibly damaging 0.72
R5704:Tbxas1 UTSW 6 39021133 missense probably benign 0.20
R6358:Tbxas1 UTSW 6 38952112 intron probably benign
R6455:Tbxas1 UTSW 6 38952145 intron probably benign
R6823:Tbxas1 UTSW 6 38919153 start codon destroyed possibly damaging 0.94
R6868:Tbxas1 UTSW 6 39084306 missense probably damaging 1.00
R6888:Tbxas1 UTSW 6 38952074 intron probably benign
R7500:Tbxas1 UTSW 6 38982212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCTGAGAAGCGCCAAGTC -3'
(R):5'- GCTCTGGAAAGCTCAGAATGG -3'

Sequencing Primer
(F):5'- TCCCAAGTGGCTCTGATTCAAGG -3'
(R):5'- CTCTGGAAAGCTCAGAATGGGAGAC -3'
Posted On2016-04-15