Incidental Mutation 'R4935:Kcnc2'
ID380314
Institutional Source Beutler Lab
Gene Symbol Kcnc2
Ensembl Gene ENSMUSG00000035681
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 2
SynonymsKv3.2, KShIIIA
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location112271121-112467024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112272228 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 175 (T175A)
Ref Sequence ENSEMBL: ENSMUSP00000089814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092175] [ENSMUST00000219301]
Predicted Effect probably benign
Transcript: ENSMUST00000092175
AA Change: T175A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089814
Gene: ENSMUSG00000035681
AA Change: T175A

DomainStartEndE-ValueType
BTB 8 163 2.53e-17 SMART
Pfam:Ion_trans 232 488 1e-46 PFAM
Pfam:Ion_trans_2 388 481 5.8e-13 PFAM
low complexity region 552 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219301
AA Change: T175A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired fast spiking in cortical interneurons, distorted cortical rhythmic activity, enhanced susceptibility to seizures, increased anxiety in the open field, and abnormal sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Kcnc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kcnc2 APN 10 112461988 missense probably damaging 0.99
IGL00595:Kcnc2 APN 10 112461987 missense probably benign 0.04
IGL01646:Kcnc2 APN 10 112272406 critical splice donor site probably null
IGL01950:Kcnc2 APN 10 112462075 intron probably benign
IGL02036:Kcnc2 APN 10 112455926 missense possibly damaging 0.94
IGL02164:Kcnc2 APN 10 112455685 missense possibly damaging 0.92
IGL02447:Kcnc2 APN 10 112455946 missense probably damaging 1.00
IGL03087:Kcnc2 APN 10 112455747 missense probably benign 0.19
IGL03385:Kcnc2 APN 10 112455786 missense probably damaging 1.00
R0133:Kcnc2 UTSW 10 112458597 missense probably damaging 1.00
R1444:Kcnc2 UTSW 10 112455601 unclassified probably benign
R1474:Kcnc2 UTSW 10 112456400 missense probably damaging 1.00
R2221:Kcnc2 UTSW 10 112456526 missense probably damaging 1.00
R4504:Kcnc2 UTSW 10 112455794 missense probably damaging 1.00
R4714:Kcnc2 UTSW 10 112455828 missense possibly damaging 0.82
R6168:Kcnc2 UTSW 10 112455756 missense probably benign 0.13
R6338:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6375:Kcnc2 UTSW 10 112463189 missense possibly damaging 0.92
R6511:Kcnc2 UTSW 10 112462067 intron probably benign
R6516:Kcnc2 UTSW 10 112462000 missense probably benign 0.00
R6556:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6609:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6610:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6612:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6837:Kcnc2 UTSW 10 112458502 missense probably damaging 0.96
R7151:Kcnc2 UTSW 10 112458509 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGGAGTATTCGCCTATGTGC -3'
(R):5'- GTTGCAACAACAGGGAATGC -3'

Sequencing Primer
(F):5'- GTGCTCAATTACTACCGCACGG -3'
(R):5'- GGAATGCTAGATTCAGGTCTTACCC -3'
Posted On2016-04-15