Incidental Mutation 'R4936:Thbd'
ID380347
Institutional Source Beutler Lab
Gene Symbol Thbd
Ensembl Gene ENSMUSG00000074743
Gene Namethrombomodulin
SynonymsCD141, TM
MMRRC Submission 042536-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4936 (G1)
Quality Score86
Status Not validated
Chromosome2
Chromosomal Location148404466-148408188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148407735 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 71 (I71N)
Ref Sequence ENSEMBL: ENSMUSP00000096877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099270]
Predicted Effect probably damaging
Transcript: ENSMUST00000099270
AA Change: I71N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096877
Gene: ENSMUSG00000074743
AA Change: I71N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
CLECT 24 166 2.78e-18 SMART
EGF 243 280 2.2e1 SMART
EGF 286 323 1.47e-3 SMART
EGF_CA 324 362 7.81e-8 SMART
EGF 367 404 3.57e-2 SMART
EGF 406 439 2.53e1 SMART
EGF 443 480 2.39e1 SMART
low complexity region 490 511 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is an endothelial-specific type I membrane receptor that binds thrombin. This binding results in the activation of protein C, which degrades clotting factors Va and VIIIa and reduces the amount of thrombin generated. Mutations in this gene are a cause of thromboembolic disease, also known as inherited thrombophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants are growth retarded and die by embryonic day 9.5. Embryos develop further in vitro than in vivo suggesting maternal-fetal incompatibility. Endothelial cell-specific, conditional knockouts suffer fatal juvenile thromboses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,315 F183L possibly damaging Het
4930590J08Rik T A 6: 91,944,264 M775K probably damaging Het
Actn1 T G 12: 80,172,998 I700L probably benign Het
Adam5 T C 8: 24,786,271 Y460C probably damaging Het
Akna C T 4: 63,395,265 G207E probably damaging Het
Ank2 T A 3: 126,955,039 H527L possibly damaging Het
Anks1 C A 17: 27,988,805 N383K probably damaging Het
Apba3 C T 10: 81,269,370 probably null Het
Atp9b C A 18: 80,736,093 V1121F possibly damaging Het
Bsn T C 9: 108,111,761 Y2264C probably damaging Het
Bst1 A G 5: 43,840,457 D266G probably damaging Het
Cep55 A G 19: 38,071,754 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckb T C 12: 111,671,230 K156E probably benign Het
Cln3 T A 7: 126,575,221 H315L probably damaging Het
Cnot6l A G 5: 96,079,937 F479S probably damaging Het
Col1a1 A G 11: 94,947,132 D826G unknown Het
Cyp27a1 T C 1: 74,735,405 V194A probably benign Het
Dis3l2 C T 1: 87,044,168 P643S probably benign Het
Dpf3 T C 12: 83,331,966 D108G probably damaging Het
Eif2b4 C T 5: 31,192,897 G27D probably benign Het
Eif4a1 T G 11: 69,672,425 probably benign Het
Espl1 A T 15: 102,304,937 D566V probably damaging Het
Ext2 T A 2: 93,813,679 R86* probably null Het
Fasn A T 11: 120,816,085 F914I probably damaging Het
Fbf1 A G 11: 116,152,552 L477P probably benign Het
Fsd1 A T 17: 55,996,452 K441N possibly damaging Het
Fsip2 T A 2: 82,985,040 S3706T probably benign Het
Gabra5 A T 7: 57,408,799 N400K probably benign Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gli2 A G 1: 118,836,140 V1427A probably benign Het
Gm7334 A T 17: 50,698,827 Y47F probably damaging Het
Gm8674 T G 13: 49,900,755 noncoding transcript Het
Gmeb2 G T 2: 181,254,246 T377K probably benign Het
Gp9 T A 6: 87,779,247 D81E probably benign Het
Il5ra T A 6: 106,738,162 I212F possibly damaging Het
Klhl18 G T 9: 110,428,961 N470K possibly damaging Het
Lfng G T 5: 140,612,395 probably null Het
Lpo A G 11: 87,810,340 I430T probably benign Het
Lrrc31 C T 3: 30,689,268 D183N probably damaging Het
Meis2 T C 2: 115,864,412 T410A probably benign Het
Myo6 A G 9: 80,307,681 D1232G probably damaging Het
Ncapd2 C T 6: 125,169,840 R1261H probably benign Het
Nfkb1 C T 3: 135,613,982 V251M probably damaging Het
Nmbr C A 10: 14,766,986 H96Q probably damaging Het
Nop14 C T 5: 34,652,393 R256H probably damaging Het
Nqo2 T A 13: 33,981,518 Y133N probably damaging Het
Olfr1153 A G 2: 87,896,813 I213V probably benign Het
Olfr1366 T C 13: 21,537,187 I273V probably benign Het
Pbld2 C A 10: 63,052,238 S168R probably damaging Het
Pcdhb7 G T 18: 37,342,149 G113* probably null Het
Pcdhb7 G T 18: 37,342,150 G113V probably damaging Het
Pdgfra A T 5: 75,195,026 T1066S probably damaging Het
Prdm8 A T 5: 98,185,022 probably null Het
Prdm8 G T 5: 98,185,023 probably null Het
Prkg1 T C 19: 30,586,375 Y479C probably benign Het
Pudp T C 18: 50,568,468 T65A probably benign Het
Rbbp6 C T 7: 122,999,703 probably benign Het
Rcc1 C G 4: 132,335,735 V187L probably damaging Het
Rims2 T A 15: 39,437,728 M285K probably damaging Het
Rtkn2 T C 10: 68,041,915 *602Q probably null Het
Rxfp3 T G 15: 11,036,780 S169R probably damaging Het
Sardh T C 2: 27,228,241 probably null Het
Slc24a2 A T 4: 87,227,347 F157I probably damaging Het
Slc25a20 T C 9: 108,681,992 Y186H probably damaging Het
Slc25a24 A G 3: 109,163,548 R408G probably damaging Het
Slc44a5 T G 3: 154,253,716 I348S probably damaging Het
Slc8a2 A T 7: 16,134,175 K111* probably null Het
Smc5 A G 19: 23,234,003 V589A probably damaging Het
Thsd7b T C 1: 129,678,145 M541T probably benign Het
Tie1 T A 4: 118,484,771 silent Het
Tln1 A G 4: 43,547,522 F813S possibly damaging Het
Tnrc18 A T 5: 142,765,977 L1191* probably null Het
Tubb2a A C 13: 34,075,257 Y183* probably null Het
Ubr4 T A 4: 139,396,566 V343E probably damaging Het
Vmn2r93 A T 17: 18,304,065 D107V possibly damaging Het
Vwa5a T G 9: 38,736,198 S624R probably benign Het
Wwox G A 8: 114,706,358 V255I probably benign Het
Wwp1 T C 4: 19,638,804 K546E probably damaging Het
Xirp2 T A 2: 67,509,819 F801L possibly damaging Het
Zfp407 T C 18: 84,559,464 I1175V probably benign Het
Zfp646 T A 7: 127,881,761 C1037S possibly damaging Het
Zfp786 A T 6: 47,821,268 C245* probably null Het
Zfp827 T C 8: 79,061,183 V326A probably benign Het
Other mutations in Thbd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Thbd APN 2 148407682 nonsense probably null
IGL01510:Thbd APN 2 148406974 missense probably damaging 1.00
IGL01845:Thbd APN 2 148407096 missense probably benign
IGL01892:Thbd APN 2 148407068 missense possibly damaging 0.68
IGL02039:Thbd APN 2 148406542 missense probably benign 0.05
IGL02261:Thbd APN 2 148406481 missense probably benign
IGL02941:Thbd APN 2 148407034 missense probably damaging 1.00
IGL03110:Thbd APN 2 148406796 missense probably benign
IGL03111:Thbd APN 2 148406472 missense probably benign 0.00
F5770:Thbd UTSW 2 148407190 missense probably benign 0.05
PIT4283001:Thbd UTSW 2 148407083 missense probably benign 0.19
R0102:Thbd UTSW 2 148406983 missense probably damaging 1.00
R0102:Thbd UTSW 2 148406983 missense probably damaging 1.00
R1847:Thbd UTSW 2 148407684 nonsense probably null
R1957:Thbd UTSW 2 148406979 missense probably damaging 0.97
R2320:Thbd UTSW 2 148406646 missense probably damaging 1.00
R2362:Thbd UTSW 2 148406364 missense probably damaging 1.00
R2900:Thbd UTSW 2 148406214 makesense probably null
R3623:Thbd UTSW 2 148406973 missense probably damaging 1.00
R4839:Thbd UTSW 2 148406671 missense probably damaging 1.00
R5296:Thbd UTSW 2 148406983 missense probably damaging 1.00
R5521:Thbd UTSW 2 148407735 missense probably damaging 1.00
R5677:Thbd UTSW 2 148407366 missense probably damaging 1.00
R6581:Thbd UTSW 2 148406272 missense probably benign
R7139:Thbd UTSW 2 148406541 missense probably benign 0.37
R7246:Thbd UTSW 2 148406485 missense probably benign
V7582:Thbd UTSW 2 148407190 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTTCAGTTGCTGTCGAGACC -3'
(R):5'- GACAGCATGCTTGGGATTTTC -3'

Sequencing Primer
(F):5'- AGTTGCTGTCGAGACCGTGAC -3'
(R):5'- ACAGCATGCTTGGGATTTTCTTTCTG -3'
Posted On2016-04-15