Incidental Mutation 'R4936:Pdgfra'
ID380363
Institutional Source Beutler Lab
Gene Symbol Pdgfra
Ensembl Gene ENSMUSG00000029231
Gene Nameplatelet derived growth factor receptor, alpha polypeptide
SynonymsPdgfr-2, CD140a
MMRRC Submission 042536-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4936 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location75152292-75198215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75195026 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1066 (T1066S)
Ref Sequence ENSEMBL: ENSMUSP00000127173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000476] [ENSMUST00000168162]
Predicted Effect probably damaging
Transcript: ENSMUST00000000476
AA Change: T1066S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000476
Gene: ENSMUSG00000029231
AA Change: T1066S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168162
AA Change: T1066S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127173
Gene: ENSMUSG00000029231
AA Change: T1066S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes for targeted null mutations exhibit incomplete cephalic closure, increased apoptosis of neural crest cells, impaired myotome and testis formation, abnormal mucosal linings, thoracic skeletal defects, and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,315 F183L possibly damaging Het
4930590J08Rik T A 6: 91,944,264 M775K probably damaging Het
Actn1 T G 12: 80,172,998 I700L probably benign Het
Adam5 T C 8: 24,786,271 Y460C probably damaging Het
Akna C T 4: 63,395,265 G207E probably damaging Het
Ank2 T A 3: 126,955,039 H527L possibly damaging Het
Anks1 C A 17: 27,988,805 N383K probably damaging Het
Apba3 C T 10: 81,269,370 probably null Het
Atp9b C A 18: 80,736,093 V1121F possibly damaging Het
Bsn T C 9: 108,111,761 Y2264C probably damaging Het
Bst1 A G 5: 43,840,457 D266G probably damaging Het
Cep55 A G 19: 38,071,754 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckb T C 12: 111,671,230 K156E probably benign Het
Cln3 T A 7: 126,575,221 H315L probably damaging Het
Cnot6l A G 5: 96,079,937 F479S probably damaging Het
Col1a1 A G 11: 94,947,132 D826G unknown Het
Cyp27a1 T C 1: 74,735,405 V194A probably benign Het
Dis3l2 C T 1: 87,044,168 P643S probably benign Het
Dpf3 T C 12: 83,331,966 D108G probably damaging Het
Eif2b4 C T 5: 31,192,897 G27D probably benign Het
Eif4a1 T G 11: 69,672,425 probably benign Het
Espl1 A T 15: 102,304,937 D566V probably damaging Het
Ext2 T A 2: 93,813,679 R86* probably null Het
Fasn A T 11: 120,816,085 F914I probably damaging Het
Fbf1 A G 11: 116,152,552 L477P probably benign Het
Fsd1 A T 17: 55,996,452 K441N possibly damaging Het
Fsip2 T A 2: 82,985,040 S3706T probably benign Het
Gabra5 A T 7: 57,408,799 N400K probably benign Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gli2 A G 1: 118,836,140 V1427A probably benign Het
Gm7334 A T 17: 50,698,827 Y47F probably damaging Het
Gm8674 T G 13: 49,900,755 noncoding transcript Het
Gmeb2 G T 2: 181,254,246 T377K probably benign Het
Gp9 T A 6: 87,779,247 D81E probably benign Het
Il5ra T A 6: 106,738,162 I212F possibly damaging Het
Klhl18 G T 9: 110,428,961 N470K possibly damaging Het
Lfng G T 5: 140,612,395 probably null Het
Lpo A G 11: 87,810,340 I430T probably benign Het
Lrrc31 C T 3: 30,689,268 D183N probably damaging Het
Meis2 T C 2: 115,864,412 T410A probably benign Het
Myo6 A G 9: 80,307,681 D1232G probably damaging Het
Ncapd2 C T 6: 125,169,840 R1261H probably benign Het
Nfkb1 C T 3: 135,613,982 V251M probably damaging Het
Nmbr C A 10: 14,766,986 H96Q probably damaging Het
Nop14 C T 5: 34,652,393 R256H probably damaging Het
Nqo2 T A 13: 33,981,518 Y133N probably damaging Het
Olfr1153 A G 2: 87,896,813 I213V probably benign Het
Olfr1366 T C 13: 21,537,187 I273V probably benign Het
Pbld2 C A 10: 63,052,238 S168R probably damaging Het
Pcdhb7 G T 18: 37,342,149 G113* probably null Het
Pcdhb7 G T 18: 37,342,150 G113V probably damaging Het
Prdm8 A T 5: 98,185,022 probably null Het
Prdm8 G T 5: 98,185,023 probably null Het
Prkg1 T C 19: 30,586,375 Y479C probably benign Het
Pudp T C 18: 50,568,468 T65A probably benign Het
Rbbp6 C T 7: 122,999,703 probably benign Het
Rcc1 C G 4: 132,335,735 V187L probably damaging Het
Rims2 T A 15: 39,437,728 M285K probably damaging Het
Rtkn2 T C 10: 68,041,915 *602Q probably null Het
Rxfp3 T G 15: 11,036,780 S169R probably damaging Het
Sardh T C 2: 27,228,241 probably null Het
Slc24a2 A T 4: 87,227,347 F157I probably damaging Het
Slc25a20 T C 9: 108,681,992 Y186H probably damaging Het
Slc25a24 A G 3: 109,163,548 R408G probably damaging Het
Slc44a5 T G 3: 154,253,716 I348S probably damaging Het
Slc8a2 A T 7: 16,134,175 K111* probably null Het
Smc5 A G 19: 23,234,003 V589A probably damaging Het
Thbd A T 2: 148,407,735 I71N probably damaging Het
Thsd7b T C 1: 129,678,145 M541T probably benign Het
Tie1 T A 4: 118,484,771 silent Het
Tln1 A G 4: 43,547,522 F813S possibly damaging Het
Tnrc18 A T 5: 142,765,977 L1191* probably null Het
Tubb2a A C 13: 34,075,257 Y183* probably null Het
Ubr4 T A 4: 139,396,566 V343E probably damaging Het
Vmn2r93 A T 17: 18,304,065 D107V possibly damaging Het
Vwa5a T G 9: 38,736,198 S624R probably benign Het
Wwox G A 8: 114,706,358 V255I probably benign Het
Wwp1 T C 4: 19,638,804 K546E probably damaging Het
Xirp2 T A 2: 67,509,819 F801L possibly damaging Het
Zfp407 T C 18: 84,559,464 I1175V probably benign Het
Zfp646 T A 7: 127,881,761 C1037S possibly damaging Het
Zfp786 A T 6: 47,821,268 C245* probably null Het
Zfp827 T C 8: 79,061,183 V326A probably benign Het
Other mutations in Pdgfra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pdgfra APN 5 75163679 missense probably benign 0.40
IGL00574:Pdgfra APN 5 75181047 missense probably damaging 1.00
IGL00906:Pdgfra APN 5 75180173 missense probably benign 0.00
IGL00964:Pdgfra APN 5 75175065 missense probably damaging 1.00
IGL01467:Pdgfra APN 5 75185631 critical splice donor site probably null
IGL01485:Pdgfra APN 5 75163652 missense probably benign 0.02
IGL01556:Pdgfra APN 5 75177691 missense probably damaging 1.00
IGL01949:Pdgfra APN 5 75170665 missense probably damaging 0.98
IGL02066:Pdgfra APN 5 75170580 missense possibly damaging 0.55
IGL02271:Pdgfra APN 5 75187906 missense probably damaging 1.00
IGL02726:Pdgfra APN 5 75194957 nonsense probably null
IGL02858:Pdgfra APN 5 75194974 missense probably damaging 1.00
IGL03306:Pdgfra APN 5 75192533 missense possibly damaging 0.49
P0033:Pdgfra UTSW 5 75192561 missense probably damaging 1.00
PIT4472001:Pdgfra UTSW 5 75180246 missense probably damaging 1.00
R0134:Pdgfra UTSW 5 75166511 missense probably damaging 1.00
R0200:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0254:Pdgfra UTSW 5 75167935 missense probably damaging 1.00
R0331:Pdgfra UTSW 5 75195052 missense probably damaging 1.00
R0467:Pdgfra UTSW 5 75195036 missense probably damaging 1.00
R0532:Pdgfra UTSW 5 75170773 missense probably benign 0.00
R0608:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0765:Pdgfra UTSW 5 75187987 unclassified probably benign
R1171:Pdgfra UTSW 5 75173447 missense probably damaging 0.98
R1372:Pdgfra UTSW 5 75189263 missense probably damaging 0.96
R1530:Pdgfra UTSW 5 75189010 splice site probably null
R1585:Pdgfra UTSW 5 75192603 missense probably damaging 1.00
R1666:Pdgfra UTSW 5 75189020 missense possibly damaging 0.94
R1836:Pdgfra UTSW 5 75183014 missense possibly damaging 0.95
R1868:Pdgfra UTSW 5 75170873 missense probably benign 0.43
R1923:Pdgfra UTSW 5 75163733 missense probably benign 0.03
R2075:Pdgfra UTSW 5 75187948 missense probably damaging 1.00
R2261:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R2262:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R3028:Pdgfra UTSW 5 75174981 missense probably damaging 1.00
R3236:Pdgfra UTSW 5 75167936 missense probably damaging 1.00
R3692:Pdgfra UTSW 5 75189287 missense possibly damaging 0.54
R3701:Pdgfra UTSW 5 75180220 nonsense probably null
R3890:Pdgfra UTSW 5 75167927 missense probably null 0.57
R3901:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R3902:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R4272:Pdgfra UTSW 5 75183070 missense probably benign 0.05
R4532:Pdgfra UTSW 5 75181083 missense probably damaging 1.00
R4660:Pdgfra UTSW 5 75162271 missense possibly damaging 0.82
R4753:Pdgfra UTSW 5 75181524 missense probably damaging 1.00
R4795:Pdgfra UTSW 5 75189311 missense probably benign
R4796:Pdgfra UTSW 5 75189311 missense probably benign
R4884:Pdgfra UTSW 5 75189312 missense probably benign 0.07
R5625:Pdgfra UTSW 5 75189337 critical splice donor site probably null
R5666:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5670:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5714:Pdgfra UTSW 5 75186012 missense probably damaging 1.00
R5836:Pdgfra UTSW 5 75163774 missense possibly damaging 0.52
R6126:Pdgfra UTSW 5 75170529 missense probably benign 0.09
R6141:Pdgfra UTSW 5 75173396 missense probably damaging 0.98
R6297:Pdgfra UTSW 5 75173474 missense possibly damaging 0.88
R6363:Pdgfra UTSW 5 75170836 missense possibly damaging 0.91
R6376:Pdgfra UTSW 5 75166519 missense probably benign 0.02
R6485:Pdgfra UTSW 5 75175074 splice site probably null
R6612:Pdgfra UTSW 5 75167842 missense probably benign 0.01
R6641:Pdgfra UTSW 5 75162101 intron probably benign
R6954:Pdgfra UTSW 5 75173394 missense possibly damaging 0.82
R7110:Pdgfra UTSW 5 75189234 nonsense probably null
Z1088:Pdgfra UTSW 5 75166577 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCTTGTGCATGAGGAAAGAGTC -3'
(R):5'- TCCACACAGGCTTACCAAGG -3'

Sequencing Primer
(F):5'- AAAGAGTCCCGCTGCTTCAG -3'
(R):5'- TCGGCCTCGGGAACTTTC -3'
Posted On2016-04-15