Incidental Mutation 'R4936:Bsn'
ID380388
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
MMRRC Submission 042536-MU
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R4936 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108111761 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 2264 (Y2264C)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect probably damaging
Transcript: ENSMUST00000035208
AA Change: Y2264C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: Y2264C

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,315 F183L possibly damaging Het
4930590J08Rik T A 6: 91,944,264 M775K probably damaging Het
Actn1 T G 12: 80,172,998 I700L probably benign Het
Adam5 T C 8: 24,786,271 Y460C probably damaging Het
Akna C T 4: 63,395,265 G207E probably damaging Het
Ank2 T A 3: 126,955,039 H527L possibly damaging Het
Anks1 C A 17: 27,988,805 N383K probably damaging Het
Apba3 C T 10: 81,269,370 probably null Het
Atp9b C A 18: 80,736,093 V1121F possibly damaging Het
Bst1 A G 5: 43,840,457 D266G probably damaging Het
Cep55 A G 19: 38,071,754 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckb T C 12: 111,671,230 K156E probably benign Het
Cln3 T A 7: 126,575,221 H315L probably damaging Het
Cnot6l A G 5: 96,079,937 F484S probably damaging Het
Col1a1 A G 11: 94,947,132 D826G unknown Het
Cyp27a1 T C 1: 74,735,405 V194A probably benign Het
Dis3l2 C T 1: 87,044,168 P643S probably benign Het
Dpf3 T C 12: 83,331,966 D108G probably damaging Het
Eif2b4 C T 5: 31,192,897 G27D probably benign Het
Eif4a1 T G 11: 69,672,425 probably benign Het
Espl1 A T 15: 102,304,937 D566V probably damaging Het
Ext2 T A 2: 93,813,679 R86* probably null Het
Fasn A T 11: 120,816,085 F914I probably damaging Het
Fbf1 A G 11: 116,152,552 L477P probably benign Het
Fsd1 A T 17: 55,996,452 K441N possibly damaging Het
Fsip2 T A 2: 82,985,040 S3706T probably benign Het
Gabra5 A T 7: 57,408,799 N400K probably benign Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gli2 A G 1: 118,836,140 V1427A probably benign Het
Gm7334 A T 17: 50,698,827 Y47F probably damaging Het
Gm8674 T G 13: 49,900,755 noncoding transcript Het
Gmeb2 G T 2: 181,254,246 T377K probably benign Het
Gp9 T A 6: 87,779,247 D81E probably benign Het
Il5ra T A 6: 106,738,162 I212F possibly damaging Het
Klhl18 G T 9: 110,428,961 N470K possibly damaging Het
Lfng G T 5: 140,612,395 probably null Het
Lpo A G 11: 87,810,340 I430T probably benign Het
Lrrc31 C T 3: 30,689,268 D183N probably damaging Het
Meis2 T C 2: 115,864,412 T417A probably benign Het
Myo6 A G 9: 80,307,681 D1232G probably damaging Het
Ncapd2 C T 6: 125,169,840 R1261H probably benign Het
Nfkb1 C T 3: 135,613,982 V251M probably damaging Het
Nmbr C A 10: 14,766,986 H96Q probably damaging Het
Nop14 C T 5: 34,652,393 R256H probably damaging Het
Nqo2 T A 13: 33,981,518 Y133N probably damaging Het
Olfr1153 A G 2: 87,896,813 I213V probably benign Het
Olfr1366 T C 13: 21,537,187 I273V probably benign Het
Pbld2 C A 10: 63,052,238 S168R probably damaging Het
Pcdhb7 G T 18: 37,342,149 G113* probably null Het
Pcdhb7 G T 18: 37,342,150 G113V probably damaging Het
Pdgfra A T 5: 75,195,026 T1066S probably damaging Het
Prdm8 A T 5: 98,185,022 probably null Het
Prdm8 G T 5: 98,185,023 probably null Het
Prkg1 T C 19: 30,586,375 Y479C probably benign Het
Pudp T C 18: 50,568,468 T65A probably benign Het
Rbbp6 C T 7: 122,999,703 probably benign Het
Rcc1 C G 4: 132,335,735 V187L probably damaging Het
Rims2 T A 15: 39,437,728 M285K probably damaging Het
Rtkn2 T C 10: 68,041,915 *605Q probably null Het
Rxfp3 T G 15: 11,036,780 S169R probably damaging Het
Sardh T C 2: 27,228,241 probably null Het
Slc24a2 A T 4: 87,227,347 F157I probably damaging Het
Slc25a20 T C 9: 108,681,992 Y186H probably damaging Het
Slc25a24 A G 3: 109,163,548 R408G probably damaging Het
Slc44a5 T G 3: 154,253,716 I348S probably damaging Het
Slc8a2 A T 7: 16,134,175 K111* probably null Het
Smc5 A G 19: 23,234,003 V589A probably damaging Het
Thbd A T 2: 148,407,735 I71N probably damaging Het
Thsd7b T C 1: 129,678,145 M541T probably benign Het
Tie1 T A 4: 118,484,771 silent Het
Tln1 A G 4: 43,547,522 F813S possibly damaging Het
Tnrc18 A T 5: 142,765,977 L1373* probably null Het
Tubb2a A C 13: 34,075,257 Y183* probably null Het
Ubr4 T A 4: 139,396,566 V343E probably damaging Het
Vmn2r93 A T 17: 18,304,065 D107V possibly damaging Het
Vwa5a T G 9: 38,736,198 S624R probably benign Het
Wwox G A 8: 114,706,358 V255I probably benign Het
Wwp1 T C 4: 19,638,804 K546E probably damaging Het
Xirp2 T A 2: 67,509,819 F801L possibly damaging Het
Zfp407 T C 18: 84,559,464 I1175V probably benign Het
Zfp646 T A 7: 127,881,761 C1037S possibly damaging Het
Zfp786 A T 6: 47,821,268 C245* probably null Het
Zfp827 T C 8: 79,061,183 V326A probably benign Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 missense probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 missense probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 missense probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 missense probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 missense probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 missense probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 missense probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 missense probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 missense probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 missense probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 missense probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 missense probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTTGATGACAGCAGGGG -3'
(R):5'- CTGGAAACCTTGCTCAGTATGG -3'

Sequencing Primer
(F):5'- GCAGTTGTGGAAAAGGGTTCTTCAC -3'
(R):5'- CCGATGGCATGATCTATTCGAC -3'
Posted On2016-04-15