Incidental Mutation 'R4936:Apba3'
ID380394
Institutional Source Beutler Lab
Gene Symbol Apba3
Ensembl Gene ENSMUSG00000004931
Gene Nameamyloid beta (A4) precursor protein-binding, family A, member 3
SynonymsX11gamma, neuronal munc18-1-interacting protein 3, Mint 3, neuron-specific X11L2 protein, Mint-3, lin-10
MMRRC Submission 042536-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R4936 (G1)
Quality Score92
Status Not validated
Chromosome10
Chromosomal Location81266960-81273246 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 81269370 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045744] [ENSMUST00000046114] [ENSMUST00000057798] [ENSMUST00000218742] [ENSMUST00000219304] [ENSMUST00000219460] [ENSMUST00000219479] [ENSMUST00000220297]
Predicted Effect probably benign
Transcript: ENSMUST00000045744
SMART Domains Protein: ENSMUSP00000036438
Gene: ENSMUSG00000034917

DomainStartEndE-ValueType
PDZ 20 93 2.81e-18 SMART
low complexity region 119 162 N/A INTRINSIC
PDZ 196 264 2.71e-11 SMART
low complexity region 297 305 N/A INTRINSIC
PDZ 378 451 4.97e-19 SMART
SH3 466 539 9.96e-2 SMART
low complexity region 548 559 N/A INTRINSIC
GuKc 570 756 6.9e-46 SMART
Blast:GuKc 767 898 9e-27 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000046114
SMART Domains Protein: ENSMUSP00000039951
Gene: ENSMUSG00000034932

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Pfam:Ribosomal_L37 60 103 4.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057798
AA Change: P159L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050995
Gene: ENSMUSG00000004931
AA Change: P159L

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
PTB 213 359 3.03e-40 SMART
PDZ 400 478 3.74e-14 SMART
PDZ 492 557 9.58e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218146
Predicted Effect probably benign
Transcript: ENSMUST00000218297
Predicted Effect probably benign
Transcript: ENSMUST00000218742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219294
Predicted Effect probably benign
Transcript: ENSMUST00000219304
Predicted Effect probably benign
Transcript: ENSMUST00000219460
Predicted Effect probably benign
Transcript: ENSMUST00000219479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219919
Predicted Effect probably benign
Transcript: ENSMUST00000220297
AA Change: P159L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. This gene product is believed to be involved in signal transduction processes. This gene is a candidate gene for Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion in mutants causes abnormalities in colon morphology and physiology, increased circulating blood urea nitrogen, and decreased serum chloride, sodium and potassium levels. Surviving homozygotes display diarrhea, postnatal viability and decreased life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,315 F183L possibly damaging Het
4930590J08Rik T A 6: 91,944,264 M775K probably damaging Het
Actn1 T G 12: 80,172,998 I700L probably benign Het
Adam5 T C 8: 24,786,271 Y460C probably damaging Het
Akna C T 4: 63,395,265 G207E probably damaging Het
Ank2 T A 3: 126,955,039 H527L possibly damaging Het
Anks1 C A 17: 27,988,805 N383K probably damaging Het
Atp9b C A 18: 80,736,093 V1121F possibly damaging Het
Bsn T C 9: 108,111,761 Y2264C probably damaging Het
Bst1 A G 5: 43,840,457 D266G probably damaging Het
Cep55 A G 19: 38,071,754 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckb T C 12: 111,671,230 K156E probably benign Het
Cln3 T A 7: 126,575,221 H315L probably damaging Het
Cnot6l A G 5: 96,079,937 F479S probably damaging Het
Col1a1 A G 11: 94,947,132 D826G unknown Het
Cyp27a1 T C 1: 74,735,405 V194A probably benign Het
Dis3l2 C T 1: 87,044,168 P643S probably benign Het
Dpf3 T C 12: 83,331,966 D108G probably damaging Het
Eif2b4 C T 5: 31,192,897 G27D probably benign Het
Eif4a1 T G 11: 69,672,425 probably benign Het
Espl1 A T 15: 102,304,937 D566V probably damaging Het
Ext2 T A 2: 93,813,679 R86* probably null Het
Fasn A T 11: 120,816,085 F914I probably damaging Het
Fbf1 A G 11: 116,152,552 L477P probably benign Het
Fsd1 A T 17: 55,996,452 K441N possibly damaging Het
Fsip2 T A 2: 82,985,040 S3706T probably benign Het
Gabra5 A T 7: 57,408,799 N400K probably benign Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gli2 A G 1: 118,836,140 V1427A probably benign Het
Gm7334 A T 17: 50,698,827 Y47F probably damaging Het
Gm8674 T G 13: 49,900,755 noncoding transcript Het
Gmeb2 G T 2: 181,254,246 T377K probably benign Het
Gp9 T A 6: 87,779,247 D81E probably benign Het
Il5ra T A 6: 106,738,162 I212F possibly damaging Het
Klhl18 G T 9: 110,428,961 N470K possibly damaging Het
Lfng G T 5: 140,612,395 probably null Het
Lpo A G 11: 87,810,340 I430T probably benign Het
Lrrc31 C T 3: 30,689,268 D183N probably damaging Het
Meis2 T C 2: 115,864,412 T410A probably benign Het
Myo6 A G 9: 80,307,681 D1232G probably damaging Het
Ncapd2 C T 6: 125,169,840 R1261H probably benign Het
Nfkb1 C T 3: 135,613,982 V251M probably damaging Het
Nmbr C A 10: 14,766,986 H96Q probably damaging Het
Nop14 C T 5: 34,652,393 R256H probably damaging Het
Nqo2 T A 13: 33,981,518 Y133N probably damaging Het
Olfr1153 A G 2: 87,896,813 I213V probably benign Het
Olfr1366 T C 13: 21,537,187 I273V probably benign Het
Pbld2 C A 10: 63,052,238 S168R probably damaging Het
Pcdhb7 G T 18: 37,342,149 G113* probably null Het
Pcdhb7 G T 18: 37,342,150 G113V probably damaging Het
Pdgfra A T 5: 75,195,026 T1066S probably damaging Het
Prdm8 A T 5: 98,185,022 probably null Het
Prdm8 G T 5: 98,185,023 probably null Het
Prkg1 T C 19: 30,586,375 Y479C probably benign Het
Pudp T C 18: 50,568,468 T65A probably benign Het
Rbbp6 C T 7: 122,999,703 probably benign Het
Rcc1 C G 4: 132,335,735 V187L probably damaging Het
Rims2 T A 15: 39,437,728 M285K probably damaging Het
Rtkn2 T C 10: 68,041,915 *602Q probably null Het
Rxfp3 T G 15: 11,036,780 S169R probably damaging Het
Sardh T C 2: 27,228,241 probably null Het
Slc24a2 A T 4: 87,227,347 F157I probably damaging Het
Slc25a20 T C 9: 108,681,992 Y186H probably damaging Het
Slc25a24 A G 3: 109,163,548 R408G probably damaging Het
Slc44a5 T G 3: 154,253,716 I348S probably damaging Het
Slc8a2 A T 7: 16,134,175 K111* probably null Het
Smc5 A G 19: 23,234,003 V589A probably damaging Het
Thbd A T 2: 148,407,735 I71N probably damaging Het
Thsd7b T C 1: 129,678,145 M541T probably benign Het
Tie1 T A 4: 118,484,771 silent Het
Tln1 A G 4: 43,547,522 F813S possibly damaging Het
Tnrc18 A T 5: 142,765,977 L1191* probably null Het
Tubb2a A C 13: 34,075,257 Y183* probably null Het
Ubr4 T A 4: 139,396,566 V343E probably damaging Het
Vmn2r93 A T 17: 18,304,065 D107V possibly damaging Het
Vwa5a T G 9: 38,736,198 S624R probably benign Het
Wwox G A 8: 114,706,358 V255I probably benign Het
Wwp1 T C 4: 19,638,804 K546E probably damaging Het
Xirp2 T A 2: 67,509,819 F801L possibly damaging Het
Zfp407 T C 18: 84,559,464 I1175V probably benign Het
Zfp646 T A 7: 127,881,761 C1037S possibly damaging Het
Zfp786 A T 6: 47,821,268 C245* probably null Het
Zfp827 T C 8: 79,061,183 V326A probably benign Het
Other mutations in Apba3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Apba3 APN 10 81273067 missense probably damaging 1.00
IGL00332:Apba3 APN 10 81273067 missense probably damaging 1.00
IGL01577:Apba3 APN 10 81272219 missense probably damaging 1.00
IGL01924:Apba3 APN 10 81273073 missense probably benign 0.01
IGL02655:Apba3 APN 10 81272954 missense probably benign 0.20
IGL03163:Apba3 APN 10 81269223 unclassified probably null
R1381:Apba3 UTSW 10 81271756 missense possibly damaging 0.76
R2073:Apba3 UTSW 10 81269294 missense probably benign
R2114:Apba3 UTSW 10 81273112 missense probably damaging 1.00
R2196:Apba3 UTSW 10 81271708 missense probably damaging 1.00
R3773:Apba3 UTSW 10 81272609 unclassified probably null
R4895:Apba3 UTSW 10 81271283 critical splice donor site probably null
R6576:Apba3 UTSW 10 81273091 missense probably benign 0.04
R7141:Apba3 UTSW 10 81273055 missense probably damaging 1.00
R7305:Apba3 UTSW 10 81271233 missense probably damaging 1.00
X0020:Apba3 UTSW 10 81271049 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTTCAGCAGCTAGAAGC -3'
(R):5'- CCGGCTCTGGAAGATAAGAG -3'

Sequencing Primer
(F):5'- TTGCTACCGGCCAAGGACTTG -3'
(R):5'- AGGTGCAGGGCTGAGTC -3'
Posted On2016-04-15