Incidental Mutation 'R4936:Atp9b'
ID380419
Institutional Source Beutler Lab
Gene Symbol Atp9b
Ensembl Gene ENSMUSG00000024566
Gene NameATPase, class II, type 9B
SynonymsIIb
MMRRC Submission 042536-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R4936 (G1)
Quality Score171
Status Not validated
Chromosome18
Chromosomal Location80734141-80934058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80736093 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1121 (V1121F)
Ref Sequence ENSEMBL: ENSMUSP00000089394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091790] [ENSMUST00000225235] [ENSMUST00000225980]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091790
AA Change: V1121F

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089394
Gene: ENSMUSG00000024566
AA Change: V1121F

DomainStartEndE-ValueType
low complexity region 11 39 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 110 181 5.3e-21 PFAM
Pfam:E1-E2_ATPase 186 444 9.1e-15 PFAM
Pfam:Hydrolase 463 885 2.7e-13 PFAM
Pfam:HAD 464 882 4.8e-14 PFAM
Pfam:Cation_ATPase 563 664 3.7e-7 PFAM
Pfam:PhoLip_ATPase_C 899 1128 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225075
Predicted Effect probably benign
Transcript: ENSMUST00000225092
Predicted Effect probably benign
Transcript: ENSMUST00000225218
Predicted Effect probably benign
Transcript: ENSMUST00000225235
Predicted Effect probably benign
Transcript: ENSMUST00000225980
AA Change: V1110F

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,315 F183L possibly damaging Het
4930590J08Rik T A 6: 91,944,264 M775K probably damaging Het
Actn1 T G 12: 80,172,998 I700L probably benign Het
Adam5 T C 8: 24,786,271 Y460C probably damaging Het
Akna C T 4: 63,395,265 G207E probably damaging Het
Ank2 T A 3: 126,955,039 H527L possibly damaging Het
Anks1 C A 17: 27,988,805 N383K probably damaging Het
Apba3 C T 10: 81,269,370 probably null Het
Bsn T C 9: 108,111,761 Y2264C probably damaging Het
Bst1 A G 5: 43,840,457 D266G probably damaging Het
Cep55 A G 19: 38,071,754 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckb T C 12: 111,671,230 K156E probably benign Het
Cln3 T A 7: 126,575,221 H315L probably damaging Het
Cnot6l A G 5: 96,079,937 F479S probably damaging Het
Col1a1 A G 11: 94,947,132 D826G unknown Het
Cyp27a1 T C 1: 74,735,405 V194A probably benign Het
Dis3l2 C T 1: 87,044,168 P643S probably benign Het
Dpf3 T C 12: 83,331,966 D108G probably damaging Het
Eif2b4 C T 5: 31,192,897 G27D probably benign Het
Eif4a1 T G 11: 69,672,425 probably benign Het
Espl1 A T 15: 102,304,937 D566V probably damaging Het
Ext2 T A 2: 93,813,679 R86* probably null Het
Fasn A T 11: 120,816,085 F914I probably damaging Het
Fbf1 A G 11: 116,152,552 L477P probably benign Het
Fsd1 A T 17: 55,996,452 K441N possibly damaging Het
Fsip2 T A 2: 82,985,040 S3706T probably benign Het
Gabra5 A T 7: 57,408,799 N400K probably benign Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gli2 A G 1: 118,836,140 V1427A probably benign Het
Gm7334 A T 17: 50,698,827 Y47F probably damaging Het
Gm8674 T G 13: 49,900,755 noncoding transcript Het
Gmeb2 G T 2: 181,254,246 T377K probably benign Het
Gp9 T A 6: 87,779,247 D81E probably benign Het
Il5ra T A 6: 106,738,162 I212F possibly damaging Het
Klhl18 G T 9: 110,428,961 N470K possibly damaging Het
Lfng G T 5: 140,612,395 probably null Het
Lpo A G 11: 87,810,340 I430T probably benign Het
Lrrc31 C T 3: 30,689,268 D183N probably damaging Het
Meis2 T C 2: 115,864,412 T410A probably benign Het
Myo6 A G 9: 80,307,681 D1232G probably damaging Het
Ncapd2 C T 6: 125,169,840 R1261H probably benign Het
Nfkb1 C T 3: 135,613,982 V251M probably damaging Het
Nmbr C A 10: 14,766,986 H96Q probably damaging Het
Nop14 C T 5: 34,652,393 R256H probably damaging Het
Nqo2 T A 13: 33,981,518 Y133N probably damaging Het
Olfr1153 A G 2: 87,896,813 I213V probably benign Het
Olfr1366 T C 13: 21,537,187 I273V probably benign Het
Pbld2 C A 10: 63,052,238 S168R probably damaging Het
Pcdhb7 G T 18: 37,342,149 G113* probably null Het
Pcdhb7 G T 18: 37,342,150 G113V probably damaging Het
Pdgfra A T 5: 75,195,026 T1066S probably damaging Het
Prdm8 A T 5: 98,185,022 probably null Het
Prdm8 G T 5: 98,185,023 probably null Het
Prkg1 T C 19: 30,586,375 Y479C probably benign Het
Pudp T C 18: 50,568,468 T65A probably benign Het
Rbbp6 C T 7: 122,999,703 probably benign Het
Rcc1 C G 4: 132,335,735 V187L probably damaging Het
Rims2 T A 15: 39,437,728 M285K probably damaging Het
Rtkn2 T C 10: 68,041,915 *602Q probably null Het
Rxfp3 T G 15: 11,036,780 S169R probably damaging Het
Sardh T C 2: 27,228,241 probably null Het
Slc24a2 A T 4: 87,227,347 F157I probably damaging Het
Slc25a20 T C 9: 108,681,992 Y186H probably damaging Het
Slc25a24 A G 3: 109,163,548 R408G probably damaging Het
Slc44a5 T G 3: 154,253,716 I348S probably damaging Het
Slc8a2 A T 7: 16,134,175 K111* probably null Het
Smc5 A G 19: 23,234,003 V589A probably damaging Het
Thbd A T 2: 148,407,735 I71N probably damaging Het
Thsd7b T C 1: 129,678,145 M541T probably benign Het
Tie1 T A 4: 118,484,771 silent Het
Tln1 A G 4: 43,547,522 F813S possibly damaging Het
Tnrc18 A T 5: 142,765,977 L1191* probably null Het
Tubb2a A C 13: 34,075,257 Y183* probably null Het
Ubr4 T A 4: 139,396,566 V343E probably damaging Het
Vmn2r93 A T 17: 18,304,065 D107V possibly damaging Het
Vwa5a T G 9: 38,736,198 S624R probably benign Het
Wwox G A 8: 114,706,358 V255I probably benign Het
Wwp1 T C 4: 19,638,804 K546E probably damaging Het
Xirp2 T A 2: 67,509,819 F801L possibly damaging Het
Zfp407 T C 18: 84,559,464 I1175V probably benign Het
Zfp646 T A 7: 127,881,761 C1037S possibly damaging Het
Zfp786 A T 6: 47,821,268 C245* probably null Het
Zfp827 T C 8: 79,061,183 V326A probably benign Het
Other mutations in Atp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Atp9b APN 18 80917888 intron probably benign
IGL00769:Atp9b APN 18 80912853 missense probably benign 0.08
IGL00851:Atp9b APN 18 80765910 missense probably damaging 1.00
IGL01529:Atp9b APN 18 80844611 intron probably benign
IGL01637:Atp9b APN 18 80756455 missense probably benign 0.06
IGL01973:Atp9b APN 18 80758303 missense probably benign 0.02
IGL02082:Atp9b APN 18 80891930 intron probably benign
IGL02560:Atp9b APN 18 80762198 missense probably benign 0.23
IGL02981:Atp9b APN 18 80754289 missense possibly damaging 0.93
IGL03151:Atp9b APN 18 80776850 missense probably benign 0.28
IGL03304:Atp9b APN 18 80917877 missense probably damaging 1.00
IGL03348:Atp9b APN 18 80836422 missense possibly damaging 0.88
R0056:Atp9b UTSW 18 80765803 missense probably damaging 0.99
R0355:Atp9b UTSW 18 80909585 intron probably benign
R0366:Atp9b UTSW 18 80762102 missense probably damaging 1.00
R0557:Atp9b UTSW 18 80765922 missense probably damaging 1.00
R0612:Atp9b UTSW 18 80753956 missense possibly damaging 0.81
R1099:Atp9b UTSW 18 80858626 missense probably damaging 1.00
R1126:Atp9b UTSW 18 80778954 missense probably damaging 1.00
R1499:Atp9b UTSW 18 80762138 missense probably damaging 0.99
R1499:Atp9b UTSW 18 80778907 missense probably benign 0.02
R1764:Atp9b UTSW 18 80909591 critical splice donor site probably null
R1780:Atp9b UTSW 18 80776897 nonsense probably null
R1782:Atp9b UTSW 18 80765922 missense probably damaging 1.00
R1835:Atp9b UTSW 18 80778883 missense probably benign 0.00
R1859:Atp9b UTSW 18 80749920 missense possibly damaging 0.95
R1953:Atp9b UTSW 18 80754307 missense possibly damaging 0.80
R2140:Atp9b UTSW 18 80736087 missense probably damaging 0.99
R2191:Atp9b UTSW 18 80753051 missense probably damaging 1.00
R4118:Atp9b UTSW 18 80749829 missense possibly damaging 0.83
R4605:Atp9b UTSW 18 80753149 critical splice acceptor site probably null
R4654:Atp9b UTSW 18 80891878 missense probably benign 0.00
R4767:Atp9b UTSW 18 80753070 missense probably damaging 1.00
R4775:Atp9b UTSW 18 80765769 critical splice donor site probably null
R5096:Atp9b UTSW 18 80762184 missense probably benign 0.39
R5279:Atp9b UTSW 18 80912858 missense probably damaging 0.98
R5394:Atp9b UTSW 18 80776837 missense probably benign 0.16
R5774:Atp9b UTSW 18 80933932 missense probably damaging 0.96
R5877:Atp9b UTSW 18 80752789 missense probably benign
R6080:Atp9b UTSW 18 80738808 missense probably benign 0.03
R6170:Atp9b UTSW 18 80877347 missense probably benign 0.16
R6250:Atp9b UTSW 18 80756521 missense probably benign 0.01
R6340:Atp9b UTSW 18 80778900 missense probably benign 0.38
R6498:Atp9b UTSW 18 80777015 missense probably benign 0.03
R6620:Atp9b UTSW 18 80808687 nonsense probably null
R6632:Atp9b UTSW 18 80808649 missense probably damaging 1.00
R6665:Atp9b UTSW 18 80917735 missense probably benign 0.26
R6821:Atp9b UTSW 18 80847248 missense probably damaging 1.00
R6927:Atp9b UTSW 18 80891857 missense possibly damaging 0.63
R6977:Atp9b UTSW 18 80753102 missense probably damaging 1.00
R7133:Atp9b UTSW 18 80909656 missense
R7188:Atp9b UTSW 18 80917826 missense
Predicted Primers PCR Primer
(F):5'- TCTCAGTAGCTGTTCACGCAG -3'
(R):5'- ACACTTTGGACTGCTGAGGTC -3'

Sequencing Primer
(F):5'- ACGCAGTGCAATGCTGG -3'
(R):5'- TGTGTCACACAGCCATGATG -3'
Posted On2016-04-15