Incidental Mutation 'R0399:Grid2'
ID38047
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Nameglutamate receptor, ionotropic, delta 2
SynonymsGluRdelta2, tpr, B230104L07Rik
MMRRC Submission 038604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0399 (G1)
Quality Score171
Status Not validated
Chromosome6
Chromosomal Location63255876-64704323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64666052 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 933 (I933V)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852] [ENSMUST00000210324]
Predicted Effect probably benign
Transcript: ENSMUST00000095852
AA Change: I933V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: I933V

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210324
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,959 probably benign Het
6030452D12Rik T C 8: 106,504,542 M120T unknown Het
Actr1a A T 19: 46,385,011 probably null Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Anapc5 A T 5: 122,791,753 V555D probably damaging Het
Aox1 A G 1: 58,068,849 probably null Het
Arhgap30 A G 1: 171,404,816 E343G probably damaging Het
Asap2 C T 12: 21,217,997 T291I possibly damaging Het
Atp5a1 T A 18: 77,781,836 Y439* probably null Het
Auts2 A T 5: 131,440,524 S428T probably benign Het
B3gnt7 T A 1: 86,305,711 C109* probably null Het
C4b C A 17: 34,728,869 Q1657H probably damaging Het
Cadm2 A T 16: 66,747,339 L268* probably null Het
Cep290 G A 10: 100,554,400 probably benign Het
Cep68 T G 11: 20,230,571 I687L probably benign Het
Chd6 T A 2: 161,052,688 D84V probably damaging Het
Clpx A G 9: 65,322,769 T514A probably benign Het
Cox18 A T 5: 90,215,028 C324S probably benign Het
Cryzl2 T C 1: 157,462,016 Y75H probably damaging Het
Cxcr6 C T 9: 123,810,951 A339V possibly damaging Het
Dock1 T C 7: 135,163,442 L1721P probably benign Het
Dstyk T C 1: 132,453,080 probably benign Het
Ehf A G 2: 103,266,870 Y246H probably damaging Het
Epas1 T C 17: 86,805,193 V73A probably benign Het
Filip1 A G 9: 79,818,310 I1009T possibly damaging Het
Glis3 A T 19: 28,298,768 probably benign Het
Gm17333 A T 16: 77,852,790 noncoding transcript Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Gpr155 A T 2: 73,370,002 I387N possibly damaging Het
Gria1 A G 11: 57,186,027 D83G probably damaging Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hook2 A G 8: 84,993,567 probably benign Het
Ift140 T A 17: 25,050,340 S656R possibly damaging Het
Il11ra1 A T 4: 41,766,185 T241S probably benign Het
Kank1 A G 19: 25,411,242 I760V probably benign Het
Kansl1 T C 11: 104,424,132 E360G possibly damaging Het
Klf9 A T 19: 23,142,082 S110C probably damaging Het
Klhl31 A G 9: 77,650,653 N217S probably benign Het
Lct T C 1: 128,300,525 Y1077C probably damaging Het
Lrrc49 A T 9: 60,610,246 probably benign Het
Lrrn1 T A 6: 107,569,120 H626Q probably benign Het
Mmp28 A T 11: 83,451,732 L40Q probably damaging Het
Mroh1 C T 15: 76,452,099 A1530V probably benign Het
Myo1e A G 9: 70,301,793 probably benign Het
Naa25 A T 5: 121,435,490 M761L probably benign Het
Ncln G A 10: 81,488,297 A465V probably damaging Het
Nktr A G 9: 121,731,484 N98S probably damaging Het
Olfr1012 T C 2: 85,759,904 I157M possibly damaging Het
Olfr215 C A 6: 116,582,781 S55I probably benign Het
Olfr651 T A 7: 104,553,369 V150E probably benign Het
Olfr76 G C 19: 12,120,370 A114G possibly damaging Het
Olfr878 G T 9: 37,919,553 A304S possibly damaging Het
Pacsin2 T C 15: 83,386,782 Y222C probably damaging Het
Pcdhb15 C T 18: 37,474,168 T151M possibly damaging Het
Plcz1 C A 6: 140,023,230 V161L possibly damaging Het
Ppp6c G A 2: 39,200,124 probably benign Het
Rhbdf2 T A 11: 116,603,992 Y286F probably benign Het
Rtn3 A T 19: 7,457,876 D231E probably damaging Het
Slc35c2 A C 2: 165,280,895 Y156* probably null Het
Spata46 A G 1: 170,311,537 D35G probably damaging Het
Tmed3 A G 9: 89,702,873 F110L possibly damaging Het
Tmem104 T G 11: 115,201,308 probably benign Het
Tpbg T A 9: 85,844,938 V320E possibly damaging Het
Trib2 T C 12: 15,793,663 D190G probably damaging Het
Tspan2 A G 3: 102,759,385 T26A probably damaging Het
Usp17lb A C 7: 104,841,151 Y190D possibly damaging Het
Utp18 C T 11: 93,880,147 probably benign Het
Utp20 A T 10: 88,820,979 D121E probably damaging Het
Vmn1r80 T A 7: 12,193,317 M118K possibly damaging Het
Vmn1r84 T C 7: 12,361,867 S300G probably benign Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64345589 missense probably damaging 1.00
IGL00596:Grid2 APN 6 64533704 missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64320196 missense probably benign 0.00
IGL01712:Grid2 APN 6 64665915 missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64063935 missense probably benign 0.29
IGL02216:Grid2 APN 6 64345666 missense probably damaging 0.96
IGL02563:Grid2 APN 6 64345873 missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64345816 missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64063904 missense probably damaging 0.98
IGL03324:Grid2 APN 6 64429822 missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63909069 missense possibly damaging 0.94
crawler UTSW 6 64429694 nonsense probably null
swagger UTSW 6 64395280 synonymous probably benign
R0133:Grid2 UTSW 6 64320132 missense probably damaging 1.00
R0147:Grid2 UTSW 6 64533587 missense probably benign
R0193:Grid2 UTSW 6 64063953 missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64345734 missense possibly damaging 0.75
R0600:Grid2 UTSW 6 63503435 missense probably benign 0.38
R0717:Grid2 UTSW 6 64666275 missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64429754 missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64429684 missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64429694 nonsense probably null
R1762:Grid2 UTSW 6 64533654 missense probably damaging 0.98
R1944:Grid2 UTSW 6 63909061 missense probably damaging 1.00
R1961:Grid2 UTSW 6 63908893 missense probably damaging 1.00
R1969:Grid2 UTSW 6 63908918 nonsense probably null
R2138:Grid2 UTSW 6 64345798 missense probably damaging 0.99
R3500:Grid2 UTSW 6 63503399 missense probably damaging 0.97
R3547:Grid2 UTSW 6 64320021 missense probably damaging 0.97
R3845:Grid2 UTSW 6 64345842 missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63503433 missense probably benign 0.41
R4273:Grid2 UTSW 6 63909045 missense probably damaging 1.00
R4591:Grid2 UTSW 6 64320102 missense probably damaging 1.00
R4701:Grid2 UTSW 6 64665915 missense probably benign 0.27
R4721:Grid2 UTSW 6 64666201 missense probably benign 0.33
R4755:Grid2 UTSW 6 63908988 missense probably benign 0.04
R4869:Grid2 UTSW 6 64429740 missense probably damaging 1.00
R5083:Grid2 UTSW 6 64320152 nonsense probably null
R5091:Grid2 UTSW 6 64076878 missense probably benign 0.07
R5117:Grid2 UTSW 6 63256933 missense probably benign 0.15
R5128:Grid2 UTSW 6 64665998 missense probably benign 0.01
R5386:Grid2 UTSW 6 63931105 missense probably damaging 0.99
R5404:Grid2 UTSW 6 63930910 missense probably damaging 0.99
R5534:Grid2 UTSW 6 63503361 missense probably benign
R5626:Grid2 UTSW 6 64076945 critical splice donor site probably null
R5699:Grid2 UTSW 6 63908991 missense probably damaging 0.99
R5700:Grid2 UTSW 6 64094432 missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64663162 missense probably damaging 1.00
R6446:Grid2 UTSW 6 64345593 missense probably damaging 1.00
R6694:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63931015 missense probably benign 0.01
R6895:Grid2 UTSW 6 64395299 missense probably damaging 0.99
R6999:Grid2 UTSW 6 64076909 missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64700418 missense unknown
R7126:Grid2 UTSW 6 64076810 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGACCTGGAGCACCTCCATAGAC -3'
(R):5'- GTTCTCAGTGACTCAGTGCCCATTC -3'

Sequencing Primer
(F):5'- CCTCCATAGACGTGTAAATAGCTTG -3'
(R):5'- aagggagaaagagggaaaaaaaag -3'
Posted On2013-05-23