Incidental Mutation 'R4937:Wdr55'
ID380529
Institutional Source Beutler Lab
Gene Symbol Wdr55
Ensembl Gene ENSMUSG00000042660
Gene NameWD repeat domain 55
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4937 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36760239-36763708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36762398 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 143 (V143I)
Ref Sequence ENSEMBL: ENSMUSP00000039010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001416] [ENSMUST00000007042] [ENSMUST00000049323] [ENSMUST00000061522]
Predicted Effect probably benign
Transcript: ENSMUST00000001416
SMART Domains Protein: ENSMUSP00000001416
Gene: ENSMUSG00000001380

DomainStartEndE-ValueType
WHEP-TRS 7 60 5.37e-11 SMART
Pfam:tRNA-synt_His 61 389 1.9e-41 PFAM
Pfam:HGTP_anticodon2 404 507 3.3e-12 PFAM
Pfam:HGTP_anticodon 410 501 4.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000007042
SMART Domains Protein: ENSMUSP00000007042
Gene: ENSMUSG00000024474

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:RED_N 76 302 1.6e-105 PFAM
low complexity region 334 380 N/A INTRINSIC
Pfam:RED_C 445 554 1.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049323
AA Change: V143I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000039010
Gene: ENSMUSG00000042660
AA Change: V143I

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
WD40 31 67 4.6e0 SMART
WD40 74 113 1.12e-2 SMART
WD40 116 155 2.4e-2 SMART
WD40 158 197 2.76e-2 SMART
WD40 202 239 1.72e0 SMART
WD40 284 324 2.01e-4 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061522
SMART Domains Protein: ENSMUSP00000054412
Gene: ENSMUSG00000044595

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
RRM 59 132 2.49e-10 SMART
RRM 139 214 3.01e-1 SMART
Pfam:DND1_DSRM 253 333 1.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224284
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,201 F597S probably benign Het
4933406M09Rik T A 1: 134,389,976 M162K probably benign Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Abca16 G T 7: 120,527,086 C1155F probably damaging Het
Adam26a T C 8: 43,568,881 D524G probably damaging Het
Adamts20 G C 15: 94,379,775 H269D probably benign Het
Akap9 T A 5: 4,050,145 probably null Het
Akt3 T C 1: 177,050,127 I358M possibly damaging Het
Aldh9a1 G T 1: 167,361,807 A375S probably damaging Het
Alg2 A G 4: 47,473,974 S105P probably benign Het
Amph A G 13: 19,104,345 T335A probably damaging Het
Ank2 C T 3: 126,962,401 V1056M probably damaging Het
Apoh A G 11: 108,407,378 D168G probably benign Het
Arfgef3 C T 10: 18,589,706 A2130T probably damaging Het
Arhgap30 A G 1: 171,403,329 D218G probably benign Het
Ascc3 C T 10: 50,823,798 P1906S probably damaging Het
Atp11b T G 3: 35,807,008 probably null Het
B4galnt2 A G 11: 95,868,429 V343A probably damaging Het
Barhl1 T C 2: 28,909,773 Y280C probably damaging Het
Bcar1 A T 8: 111,721,037 Y103N probably damaging Het
Bid A G 6: 120,895,746 I150T probably benign Het
Ccdc171 T C 4: 83,549,639 S74P probably damaging Het
Ccni A T 5: 93,188,254 probably null Het
Cct8l1 A G 5: 25,516,893 E202G probably benign Het
Cd200r3 A G 16: 44,954,259 K212E probably benign Het
Cdh19 A G 1: 110,889,964 S683P probably damaging Het
Ces2b A T 8: 104,832,781 H93L probably benign Het
Clec4a1 G A 6: 122,930,695 C114Y probably damaging Het
Dcc G T 18: 71,542,249 S636* probably null Het
Dcdc2c T C 12: 28,530,473 D187G possibly damaging Het
Dgkb G T 12: 38,114,658 E150* probably null Het
Dhx30 A G 9: 110,085,961 L884P probably damaging Het
Dmwd T G 7: 19,081,303 probably null Het
Dnah17 T A 11: 118,042,154 N3593Y probably damaging Het
Dnm2 G A 9: 21,481,337 S447N probably benign Het
Elk4 G A 1: 132,017,681 G99D probably damaging Het
Entpd1 A T 19: 40,739,521 probably benign Het
Fam114a1 T A 5: 64,979,727 D4E probably damaging Het
Fam160b1 T C 19: 57,378,637 V204A probably benign Het
Fam166b T A 4: 43,427,514 Q270L possibly damaging Het
Fbln2 A G 6: 91,264,699 D754G probably damaging Het
Foxred2 T C 15: 77,955,835 N85S probably damaging Het
Fut9 A G 4: 25,799,591 probably benign Het
Gm13023 T C 4: 143,793,837 V53A possibly damaging Het
Gm13762 T A 2: 88,973,490 I134F probably damaging Het
Gm14124 C T 2: 150,268,760 H457Y unknown Het
Gm1818 G A 12: 48,559,824 noncoding transcript Het
Gm4894 C A 9: 49,278,700 Q92K unknown Het
Gpx2 T C 12: 76,792,800 I141M probably benign Het
Gusb T C 5: 129,995,485 T476A probably damaging Het
Hmmr G A 11: 40,721,840 T180I possibly damaging Het
Itgbl1 T C 14: 123,973,368 Y493H probably benign Het
Klhdc9 G T 1: 171,360,383 C93* probably null Het
Lpar3 A G 3: 146,284,751 K275E probably damaging Het
Lrp1b A G 2: 40,802,885 probably null Het
Lrrc63 C T 14: 75,084,949 G572S probably damaging Het
Mapk11 A T 15: 89,146,482 D98E probably benign Het
Net1 G A 13: 3,884,905 R374W probably damaging Het
Nlrp4g T A 9: 124,354,005 noncoding transcript Het
Nrap T A 19: 56,347,220 Y923F probably damaging Het
Olfr53 T A 7: 140,652,621 M214K probably benign Het
Olfr811 A T 10: 129,802,063 V154E probably benign Het
Plxnc1 A G 10: 94,841,473 V964A probably damaging Het
Pmfbp1 A G 8: 109,535,866 I731V probably benign Het
Polq T A 16: 37,027,912 S294T probably benign Het
Pomgnt2 T C 9: 121,982,554 D387G probably benign Het
Prmt2 G A 10: 76,221,008 T227I probably damaging Het
Psmd1 T A 1: 86,083,225 F341I probably damaging Het
Ptpn23 T C 9: 110,392,738 M127V probably benign Het
Ptprc A G 1: 138,089,500 F483L probably damaging Het
Rab35 A C 5: 115,640,088 I38L probably damaging Het
Rapgef6 A G 11: 54,657,317 T486A probably damaging Het
Rgl3 A T 9: 21,987,708 C68* probably null Het
Rilpl1 T C 5: 124,515,531 E189G possibly damaging Het
Rnf217 T C 10: 31,517,524 I354V probably benign Het
Rspo3 T C 10: 29,506,528 D50G probably damaging Het
Sbno1 A G 5: 124,374,609 S1366P possibly damaging Het
Sema3c A G 5: 17,694,686 D392G probably benign Het
Serpinb9e A T 13: 33,252,952 Y85F probably benign Het
Shprh C T 10: 11,157,119 T283I probably benign Het
Sipa1l1 T C 12: 82,341,329 S110P probably benign Het
Slc16a12 T A 19: 34,675,243 I168F probably damaging Het
Slc23a3 A G 1: 75,132,624 S221P probably damaging Het
Slc35b3 A T 13: 38,932,911 I366K possibly damaging Het
Slc44a5 T C 3: 154,243,615 probably null Het
Slc5a12 A T 2: 110,620,408 D316V probably damaging Het
Ssr3 A G 3: 65,392,453 S29P probably damaging Het
Taf2 G A 15: 55,027,223 Q1055* probably null Het
Them6 A T 15: 74,721,518 D75V probably damaging Het
Tmem159 T C 7: 120,116,312 S120P probably damaging Het
Tom1l2 A G 11: 60,258,918 S239P probably damaging Het
Tspear A G 10: 77,875,043 T500A probably damaging Het
Tubgcp6 G A 15: 89,101,549 A1487V probably damaging Het
Uba7 G A 9: 107,978,991 V522I possibly damaging Het
Virma C A 4: 11,521,147 C901* probably null Het
Vmn1r172 A T 7: 23,659,887 I66F possibly damaging Het
Vmn2r82 A T 10: 79,379,176 Y331F probably benign Het
Zbtb49 A T 5: 38,213,963 D191E possibly damaging Het
Zfhx4 A G 3: 5,242,011 H99R probably damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp646 C T 7: 127,879,182 A177V probably benign Het
Zfp653 C T 9: 22,055,778 E604K probably damaging Het
Other mutations in Wdr55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Wdr55 APN 18 36762079 critical splice donor site probably null
IGL02720:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02723:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02726:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02728:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02729:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02731:Wdr55 APN 18 36763382 missense probably benign 0.12
R1420:Wdr55 UTSW 18 36760339 missense probably benign 0.00
R1952:Wdr55 UTSW 18 36760384 missense probably damaging 1.00
R2143:Wdr55 UTSW 18 36762366 missense possibly damaging 0.95
R2144:Wdr55 UTSW 18 36762366 missense possibly damaging 0.95
R4323:Wdr55 UTSW 18 36763100 missense probably benign 0.00
R4497:Wdr55 UTSW 18 36760395 missense possibly damaging 0.85
R5662:Wdr55 UTSW 18 36760395 missense possibly damaging 0.85
R6315:Wdr55 UTSW 18 36762069 missense probably damaging 1.00
R6499:Wdr55 UTSW 18 36762178 missense probably benign 0.00
R6679:Wdr55 UTSW 18 36763124 missense probably damaging 1.00
R7038:Wdr55 UTSW 18 36760420 missense probably damaging 1.00
R7151:Wdr55 UTSW 18 36762936 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AAGGCGAATTTCCAAGGCCC -3'
(R):5'- GAGATGGGAAGTTCCATTCTAGG -3'

Sequencing Primer
(F):5'- TTTCCAAGGCCCACAGGTAAGG -3'
(R):5'- GGCACCTATTCACCACTGG -3'
Posted On2016-04-15