Incidental Mutation 'R4931:Duox2'
ID380541
Institutional Source Beutler Lab
Gene Symbol Duox2
Ensembl Gene ENSMUSG00000068452
Gene Namedual oxidase 2
SynonymsA430065P05Rik
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4931 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122279247-122298165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122296755 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 147 (N147S)
Ref Sequence ENSEMBL: ENSMUSP00000050314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028656] [ENSMUST00000053734]
Predicted Effect probably benign
Transcript: ENSMUST00000028656
SMART Domains Protein: ENSMUSP00000028656
Gene: ENSMUSG00000027225

DomainStartEndE-ValueType
Pfam:DuoxA 10 286 5.5e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053734
AA Change: N147S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000050314
Gene: ENSMUSG00000068452
AA Change: N147S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:An_peroxidase 35 560 5e-131 PFAM
transmembrane domain 600 622 N/A INTRINSIC
EFh 823 851 3.7e-5 SMART
EFh 859 887 2.09e-4 SMART
transmembrane domain 1010 1032 N/A INTRINSIC
Pfam:Ferric_reduct 1053 1202 1.8e-22 PFAM
Pfam:FAD_binding_8 1238 1340 3.1e-20 PFAM
Pfam:NAD_binding_6 1346 1500 1.5e-33 PFAM
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes this encoded protein and DUOX1. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation fail to breed and are congenitally hypothyroid (low T4, high TSH), dwarf, and hearing impaired. Anterior pituitaries are dysplastic. Cochlear defects include delayed formation of the inner sulcus and tunnel of Corti and a thickened tectorial membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Duox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Duox2 APN 2 122283575 missense probably benign
IGL00790:Duox2 APN 2 122292300 missense possibly damaging 0.63
IGL01346:Duox2 APN 2 122287202 splice site probably benign
IGL01607:Duox2 APN 2 122292319 missense probably benign 0.00
IGL01798:Duox2 APN 2 122281908 missense probably damaging 1.00
IGL02000:Duox2 APN 2 122290709 missense probably benign
IGL02219:Duox2 APN 2 122294664 missense probably benign 0.01
IGL02227:Duox2 APN 2 122285153 splice site probably benign
IGL02276:Duox2 APN 2 122294085 missense probably benign 0.00
IGL02447:Duox2 APN 2 122297468 missense probably damaging 0.98
IGL02806:Duox2 APN 2 122284666 missense probably damaging 1.00
IGL03091:Duox2 APN 2 122289474 missense probably benign 0.03
Bedazzled UTSW 2 122287121 missense possibly damaging 0.76
Immunox UTSW 2 122281871 missense probably benign
minor UTSW 2 122281496 missense probably damaging 1.00
paltry UTSW 2 122283060 critical splice donor site probably null
Recruit UTSW 2 122283897 missense possibly damaging 0.83
stumblebum UTSW 2 122284667 missense probably damaging 1.00
Two-bit UTSW 2 122281002 missense probably benign 0.42
R0049:Duox2 UTSW 2 122296686 missense possibly damaging 0.48
R0244:Duox2 UTSW 2 122291860 missense probably benign 0.00
R0281:Duox2 UTSW 2 122292304 missense probably benign 0.10
R0378:Duox2 UTSW 2 122284583 missense probably benign 0.00
R0383:Duox2 UTSW 2 122291810 critical splice donor site probably null
R0442:Duox2 UTSW 2 122289332 missense probably benign 0.08
R0524:Duox2 UTSW 2 122281836 missense possibly damaging 0.80
R0560:Duox2 UTSW 2 122291554 missense probably benign 0.04
R0562:Duox2 UTSW 2 122289599 missense probably damaging 1.00
R0645:Duox2 UTSW 2 122292658 missense probably damaging 1.00
R0704:Duox2 UTSW 2 122284768 missense probably benign 0.01
R0963:Duox2 UTSW 2 122287172 missense probably benign 0.03
R1254:Duox2 UTSW 2 122283478 missense probably damaging 1.00
R1442:Duox2 UTSW 2 122281751 missense probably benign 0.20
R1473:Duox2 UTSW 2 122287121 missense possibly damaging 0.76
R1489:Duox2 UTSW 2 122293396 missense probably benign
R1738:Duox2 UTSW 2 122293414 missense probably damaging 1.00
R1748:Duox2 UTSW 2 122287051 missense probably benign 0.00
R1809:Duox2 UTSW 2 122283897 missense possibly damaging 0.83
R1843:Duox2 UTSW 2 122292258 critical splice donor site probably null
R1903:Duox2 UTSW 2 122295351 missense probably damaging 1.00
R1962:Duox2 UTSW 2 122297372 splice site probably null
R2069:Duox2 UTSW 2 122287108 missense probably benign 0.01
R2073:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2074:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2075:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2085:Duox2 UTSW 2 122280967 missense probably damaging 1.00
R3123:Duox2 UTSW 2 122281073 splice site probably benign
R3907:Duox2 UTSW 2 122283060 critical splice donor site probably null
R4572:Duox2 UTSW 2 122281726 missense probably benign 0.00
R4614:Duox2 UTSW 2 122289557 missense probably damaging 1.00
R4675:Duox2 UTSW 2 122280933 missense probably damaging 1.00
R4770:Duox2 UTSW 2 122284916 missense probably benign 0.01
R4817:Duox2 UTSW 2 122296515 missense probably damaging 0.98
R5138:Duox2 UTSW 2 122297531 missense probably damaging 1.00
R5288:Duox2 UTSW 2 122295136 missense probably benign
R5344:Duox2 UTSW 2 122281871 missense probably benign
R5385:Duox2 UTSW 2 122295136 missense probably benign
R5386:Duox2 UTSW 2 122295136 missense probably benign
R5493:Duox2 UTSW 2 122281496 missense probably damaging 1.00
R5632:Duox2 UTSW 2 122281455 missense probably damaging 1.00
R5742:Duox2 UTSW 2 122284921 missense probably benign 0.00
R6228:Duox2 UTSW 2 122287193 missense probably benign 0.38
R6380:Duox2 UTSW 2 122281002 missense probably benign 0.42
R6398:Duox2 UTSW 2 122296370 missense probably benign 0.06
R6409:Duox2 UTSW 2 122284667 missense probably damaging 1.00
R6527:Duox2 UTSW 2 122294614 missense probably benign 0.29
R6596:Duox2 UTSW 2 122285338 missense probably benign
R6719:Duox2 UTSW 2 122284386 intron probably null
R6981:Duox2 UTSW 2 122291227 missense possibly damaging 0.95
R7036:Duox2 UTSW 2 122280453 missense probably damaging 1.00
R7073:Duox2 UTSW 2 122289307 missense probably damaging 1.00
R7105:Duox2 UTSW 2 122289552 missense possibly damaging 0.93
R7127:Duox2 UTSW 2 122291949 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCTCCTCAGAGTGTCACTC -3'
(R):5'- GGCCTCTGTGTCCTGATAATTC -3'

Sequencing Primer
(F):5'- CTCAGAGTGTCACTCCAGGAATG -3'
(R):5'- GATAATTCAGAGGCTCTCCTAAGG -3'
Posted On2016-04-15