Incidental Mutation 'R4931:Fbrsl1'
ID380551
Institutional Source Beutler Lab
Gene Symbol Fbrsl1
Ensembl Gene ENSMUSG00000043323
Gene Namefibrosin-like 1
Synonyms2410025L10Rik, LOC381668
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R4931 (G1)
Quality Score190
Status Validated
Chromosome5
Chromosomal Location110361754-110448503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110379029 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 373 (S373T)
Ref Sequence ENSEMBL: ENSMUSP00000142625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056124] [ENSMUST00000069483] [ENSMUST00000196801] [ENSMUST00000198768] [ENSMUST00000198834]
Predicted Effect probably benign
Transcript: ENSMUST00000056124
SMART Domains Protein: ENSMUSP00000054613
Gene: ENSMUSG00000043323

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 82 100 N/A INTRINSIC
Pfam:Auts2 125 329 3.1e-96 PFAM
low complexity region 464 480 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000069483
AA Change: S373T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063879
Gene: ENSMUSG00000043323
AA Change: S373T

DomainStartEndE-ValueType
low complexity region 6 30 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
low complexity region 269 286 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 377 410 N/A INTRINSIC
low complexity region 476 493 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Pfam:Auts2 564 767 1.9e-95 PFAM
low complexity region 902 918 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
low complexity region 966 980 N/A INTRINSIC
low complexity region 981 997 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196801
AA Change: S373T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142625
Gene: ENSMUSG00000043323
AA Change: S373T

DomainStartEndE-ValueType
low complexity region 6 30 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
low complexity region 269 286 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 377 410 N/A INTRINSIC
low complexity region 447 456 N/A INTRINSIC
low complexity region 489 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198768
AA Change: S210T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142379
Gene: ENSMUSG00000043323
AA Change: S210T

DomainStartEndE-ValueType
low complexity region 17 38 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198834
SMART Domains Protein: ENSMUSP00000143147
Gene: ENSMUSG00000043323

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 82 100 N/A INTRINSIC
Pfam:Auts2 150 353 4.1e-107 PFAM
low complexity region 488 504 N/A INTRINSIC
low complexity region 522 537 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Fbrsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Fbrsl1 APN 5 110378248 missense probably damaging 0.99
IGL01743:Fbrsl1 APN 5 110381640 missense probably damaging 0.98
IGL01910:Fbrsl1 APN 5 110363736 missense probably damaging 1.00
F5770:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
FR4342:Fbrsl1 UTSW 5 110378125 small insertion probably benign
FR4589:Fbrsl1 UTSW 5 110378150 small insertion probably benign
R0084:Fbrsl1 UTSW 5 110379515 missense probably damaging 0.99
R0126:Fbrsl1 UTSW 5 110396040 splice site probably benign
R0336:Fbrsl1 UTSW 5 110447951 missense probably damaging 0.96
R1196:Fbrsl1 UTSW 5 110374519 missense probably benign 0.21
R1712:Fbrsl1 UTSW 5 110447996 missense probably benign 0.01
R1998:Fbrsl1 UTSW 5 110376439 missense probably benign 0.43
R2081:Fbrsl1 UTSW 5 110371625 critical splice acceptor site probably null
R2108:Fbrsl1 UTSW 5 110378434 missense probably damaging 0.97
R4420:Fbrsl1 UTSW 5 110378986 missense possibly damaging 0.66
R4472:Fbrsl1 UTSW 5 110379066 start gained probably benign
R4994:Fbrsl1 UTSW 5 110447951 missense probably damaging 0.96
R5025:Fbrsl1 UTSW 5 110417901 missense probably damaging 0.99
R5084:Fbrsl1 UTSW 5 110379406 start gained probably benign
R5326:Fbrsl1 UTSW 5 110378441 missense probably damaging 1.00
R5542:Fbrsl1 UTSW 5 110378441 missense probably damaging 1.00
R5590:Fbrsl1 UTSW 5 110381618 missense probably damaging 0.96
R6168:Fbrsl1 UTSW 5 110396056 missense probably damaging 0.97
R6234:Fbrsl1 UTSW 5 110378051 missense probably damaging 0.97
R6325:Fbrsl1 UTSW 5 110377407 missense probably damaging 1.00
R6661:Fbrsl1 UTSW 5 110378097 missense probably damaging 1.00
V7582:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0018:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0019:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0020:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0021:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0022:Fbrsl1 UTSW 5 110371549 missense probably damaging 1.00
X0022:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0023:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0024:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0027:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0050:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0052:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0053:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0054:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0057:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0058:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0060:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0061:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0062:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0063:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0064:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0065:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0066:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0067:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTACAGAATCCTCGAAGATCCC -3'
(R):5'- AGCTCAGCACGGAAGCTTTC -3'

Sequencing Primer
(F):5'- GAAGGGCTGGCTCACAAACC -3'
(R):5'- AGAGAAGCGCCCGTTGTAC -3'
Posted On2016-04-15