Incidental Mutation 'R4931:Eps8l1'
ID380558
Institutional Source Beutler Lab
Gene Symbol Eps8l1
Ensembl Gene ENSMUSG00000006154
Gene NameEPS8-like 1
Synonyms4632407K17Rik, 2310051G19Rik, DRC3, EPS8R1
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4931 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4460674-4480487 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4471241 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 237 (E237G)
Ref Sequence ENSEMBL: ENSMUSP00000133206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086372] [ENSMUST00000163137] [ENSMUST00000163804] [ENSMUST00000163893] [ENSMUST00000167298] [ENSMUST00000167810] [ENSMUST00000169820] [ENSMUST00000170635] [ENSMUST00000171445]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086372
AA Change: E176G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154
AA Change: E176G

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146199
Predicted Effect probably benign
Transcript: ENSMUST00000163137
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163804
Predicted Effect possibly damaging
Transcript: ENSMUST00000163893
AA Change: E176G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154
AA Change: E176G

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167068
Predicted Effect probably benign
Transcript: ENSMUST00000167298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167599
Predicted Effect probably benign
Transcript: ENSMUST00000167810
SMART Domains Protein: ENSMUSP00000126720
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 152 5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169820
SMART Domains Protein: ENSMUSP00000131773
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 93 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170423
Predicted Effect probably benign
Transcript: ENSMUST00000170635
SMART Domains Protein: ENSMUSP00000127999
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
PDB:2CY5|A 26 52 3e-13 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000171445
AA Change: E237G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154
AA Change: E237G

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171665
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. At least two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Eps8l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Eps8l1 APN 7 4478920 utr 3 prime probably benign
IGL01455:Eps8l1 APN 7 4478923 utr 3 prime probably benign
IGL01872:Eps8l1 APN 7 4472296 splice site probably benign
IGL02343:Eps8l1 APN 7 4472124 missense probably benign 0.04
IGL02585:Eps8l1 APN 7 4469213 missense probably damaging 1.00
IGL02596:Eps8l1 APN 7 4470872 missense probably damaging 0.99
IGL02673:Eps8l1 APN 7 4478732 missense probably damaging 1.00
IGL03117:Eps8l1 APN 7 4470887 missense probably damaging 1.00
anamnestic UTSW 7 4470874 missense probably damaging 0.98
souvenir UTSW 7 4477896 missense possibly damaging 0.56
PIT4142001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4151001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4480001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
R0015:Eps8l1 UTSW 7 4477557 splice site probably benign
R0599:Eps8l1 UTSW 7 4477957 missense possibly damaging 0.90
R0686:Eps8l1 UTSW 7 4477450 missense probably benign 0.36
R0827:Eps8l1 UTSW 7 4477389 missense possibly damaging 0.86
R1015:Eps8l1 UTSW 7 4469933 missense probably damaging 1.00
R1447:Eps8l1 UTSW 7 4474056 missense probably damaging 1.00
R1490:Eps8l1 UTSW 7 4470889 missense probably damaging 1.00
R1527:Eps8l1 UTSW 7 4471394 missense probably benign
R1553:Eps8l1 UTSW 7 4477449 missense probably damaging 0.98
R1763:Eps8l1 UTSW 7 4471823 missense probably benign 0.43
R1863:Eps8l1 UTSW 7 4465360 utr 5 prime probably benign
R2357:Eps8l1 UTSW 7 4470355 missense probably benign 0.06
R3153:Eps8l1 UTSW 7 4471799 missense probably damaging 1.00
R4082:Eps8l1 UTSW 7 4470798 splice site probably null
R4539:Eps8l1 UTSW 7 4478624 missense probably damaging 1.00
R4684:Eps8l1 UTSW 7 4473945 missense probably damaging 0.99
R4930:Eps8l1 UTSW 7 4460916 missense possibly damaging 0.66
R5245:Eps8l1 UTSW 7 4470874 missense probably damaging 0.98
R5247:Eps8l1 UTSW 7 4470402 missense probably damaging 1.00
R5305:Eps8l1 UTSW 7 4477896 missense possibly damaging 0.56
R5420:Eps8l1 UTSW 7 4470161 intron probably null
R5620:Eps8l1 UTSW 7 4460946 missense possibly damaging 0.83
R5705:Eps8l1 UTSW 7 4470035 missense probably benign 0.00
R6063:Eps8l1 UTSW 7 4471297 missense possibly damaging 0.56
R6909:Eps8l1 UTSW 7 4469900 nonsense probably null
R7096:Eps8l1 UTSW 7 4474191 missense probably benign 0.01
R7136:Eps8l1 UTSW 7 4477404 missense probably damaging 1.00
R7144:Eps8l1 UTSW 7 4472185 missense probably damaging 1.00
X0060:Eps8l1 UTSW 7 4470851 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTAGCCTTGGCCAGGTCTTAC -3'
(R):5'- TAGGGTCAGCACTGCTAGTC -3'

Sequencing Primer
(F):5'- TGTACCTCCCAGACAAGGTG -3'
(R):5'- AGCACTGCTAGTCGTGCGAG -3'
Posted On2016-04-15