Incidental Mutation 'R4931:Gpatch8'
ID380583
Institutional Source Beutler Lab
Gene Symbol Gpatch8
Ensembl Gene ENSMUSG00000034621
Gene NameG patch domain containing 8
SynonymsENSMUSG00000075516, Fbm1, 5430405G24Rik, Gpatc8
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R4931 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102475915-102556392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102481224 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 496 (E496G)
Ref Sequence ENSEMBL: ENSMUSP00000120649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143842]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069673
Predicted Effect unknown
Transcript: ENSMUST00000143842
AA Change: E496G
SMART Domains Protein: ENSMUSP00000120649
Gene: ENSMUSG00000034621
AA Change: E496G

DomainStartEndE-ValueType
G_patch 38 84 6.03e-12 SMART
coiled coil region 89 130 N/A INTRINSIC
ZnF_C2H2 136 160 6.4e0 SMART
coiled coil region 183 209 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
internal_repeat_1 307 391 1.55e-5 PROSPERO
low complexity region 474 490 N/A INTRINSIC
internal_repeat_1 583 658 1.55e-5 PROSPERO
low complexity region 666 687 N/A INTRINSIC
low complexity region 691 720 N/A INTRINSIC
low complexity region 722 753 N/A INTRINSIC
low complexity region 761 772 N/A INTRINSIC
low complexity region 798 820 N/A INTRINSIC
low complexity region 829 885 N/A INTRINSIC
low complexity region 887 980 N/A INTRINSIC
low complexity region 988 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1208 1217 N/A INTRINSIC
low complexity region 1326 1342 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1379 1404 N/A INTRINSIC
low complexity region 1438 1452 N/A INTRINSIC
low complexity region 1463 1490 N/A INTRINSIC
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an RNA-processing domain, a zinc finger domain, a lysine-rich region and a serine-rich region. A mutation in the serine-rich region of the protein is thought to be associated with hyperuricemia (PMID: 21594610). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Gpatch8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Gpatch8 APN 11 102478878 missense probably damaging 1.00
IGL00590:Gpatch8 APN 11 102480549 missense unknown
IGL00835:Gpatch8 APN 11 102478549 missense probably damaging 1.00
IGL00971:Gpatch8 APN 11 102479917 missense unknown
IGL01395:Gpatch8 APN 11 102480708 missense unknown
IGL02386:Gpatch8 APN 11 102508157 missense unknown
IGL02476:Gpatch8 APN 11 102478591 missense probably damaging 1.00
IGL02809:Gpatch8 APN 11 102487590 missense unknown
IGL02985:Gpatch8 APN 11 102481510 missense unknown
IGL03013:Gpatch8 APN 11 102508197 missense unknown
PIT4810001:Gpatch8 UTSW 11 102481842 missense unknown
R0332:Gpatch8 UTSW 11 102481842 missense unknown
R0464:Gpatch8 UTSW 11 102480886 missense unknown
R0710:Gpatch8 UTSW 11 102481933 missense unknown
R0734:Gpatch8 UTSW 11 102481400 missense unknown
R1458:Gpatch8 UTSW 11 102481229 missense unknown
R1919:Gpatch8 UTSW 11 102508142 critical splice donor site probably null
R2007:Gpatch8 UTSW 11 102500831 missense unknown
R2495:Gpatch8 UTSW 11 102478481 missense probably damaging 1.00
R2881:Gpatch8 UTSW 11 102479917 missense unknown
R2939:Gpatch8 UTSW 11 102508184 missense unknown
R4672:Gpatch8 UTSW 11 102478958 missense probably damaging 1.00
R4903:Gpatch8 UTSW 11 102480133 missense unknown
R5230:Gpatch8 UTSW 11 102479578 missense probably damaging 1.00
R5288:Gpatch8 UTSW 11 102508227 intron probably null
R5384:Gpatch8 UTSW 11 102508227 intron probably null
R5386:Gpatch8 UTSW 11 102508227 intron probably null
R5564:Gpatch8 UTSW 11 102538285 missense unknown
R5668:Gpatch8 UTSW 11 102500867 missense unknown
R5954:Gpatch8 UTSW 11 102480941 missense unknown
R5966:Gpatch8 UTSW 11 102480232 missense unknown
R6018:Gpatch8 UTSW 11 102480915 missense unknown
R6176:Gpatch8 UTSW 11 102487524 missense unknown
R6388:Gpatch8 UTSW 11 102478488 missense probably damaging 1.00
R7153:Gpatch8 UTSW 11 102480188 small insertion probably benign
Z1088:Gpatch8 UTSW 11 102480945 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGCTCTGCTTTGGTGAAAATG -3'
(R):5'- GGGGATCATAGTGCACACTC -3'

Sequencing Primer
(F):5'- AATGAGTAGTTCTGATGGCCAC -3'
(R):5'- GATCATAGTGCACACTCAAAGAG -3'
Posted On2016-04-15