Incidental Mutation 'R4931:Rad1'
ID380590
Institutional Source Beutler Lab
Gene Symbol Rad1
Ensembl Gene ENSMUSG00000022248
Gene NameRAD1 checkpoint DNA exonuclease
Synonyms
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R4931 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location10486018-10499063 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 10492762 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022856] [ENSMUST00000100775] [ENSMUST00000168408] [ENSMUST00000169519] [ENSMUST00000170100]
Predicted Effect probably benign
Transcript: ENSMUST00000022856
SMART Domains Protein: ENSMUSP00000022856
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 257 2.2e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100775
SMART Domains Protein: ENSMUSP00000098338
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 235 5.5e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168408
SMART Domains Protein: ENSMUSP00000132747
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 67 1.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169519
SMART Domains Protein: ENSMUSP00000126645
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 133 9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170100
SMART Domains Protein: ENSMUSP00000128601
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 1 161 1.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170531
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9-1-1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9-1-1 complex is recruited by RAD17 to affected sites where it may attract specialized DNA polymerases and other DNA repair effectors. Alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit normal B cell DNA damage sensitivity, somatic hypermutation, and class switch recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Rad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Rad1 APN 15 10490409 missense probably benign 0.06
IGL01536:Rad1 APN 15 10493200 missense possibly damaging 0.94
IGL01544:Rad1 APN 15 10490379 missense probably damaging 0.99
IGL02058:Rad1 APN 15 10493275 missense probably benign 0.01
IGL02368:Rad1 APN 15 10493251 missense probably benign 0.19
IGL02793:Rad1 APN 15 10493279 missense probably benign 0.00
IGL02875:Rad1 APN 15 10493279 missense probably benign 0.00
R0271:Rad1 UTSW 15 10490457 unclassified probably null
R1874:Rad1 UTSW 15 10488006 missense probably damaging 1.00
R2154:Rad1 UTSW 15 10486635 missense possibly damaging 0.77
R2318:Rad1 UTSW 15 10490409 missense probably benign 0.06
R2369:Rad1 UTSW 15 10486659 missense probably damaging 1.00
R2875:Rad1 UTSW 15 10490331 missense probably benign 0.09
R2876:Rad1 UTSW 15 10490331 missense probably benign 0.09
R2915:Rad1 UTSW 15 10486642 missense probably damaging 0.99
R3721:Rad1 UTSW 15 10488026 missense probably benign 0.00
R4754:Rad1 UTSW 15 10493126 intron probably benign
R5274:Rad1 UTSW 15 10487973 intron probably null
R5640:Rad1 UTSW 15 10495923 missense possibly damaging 0.47
R5885:Rad1 UTSW 15 10488057 missense probably damaging 1.00
R6056:Rad1 UTSW 15 10488074 missense probably damaging 0.99
R6341:Rad1 UTSW 15 10492821 missense probably damaging 0.99
R6420:Rad1 UTSW 15 10488012 missense probably benign 0.00
R7068:Rad1 UTSW 15 10490293 nonsense probably null
R7205:Rad1 UTSW 15 10493257 missense probably benign 0.00
R7312:Rad1 UTSW 15 10493281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGGGGTTCCTCTATTGCC -3'
(R):5'- GTAAATCTAGTGCCAACCATCTACTC -3'

Sequencing Primer
(F):5'- CTAGTCTCCGTACCTGAGTGATAG -3'
(R):5'- CCAAGTCGGAATCTTTGG -3'
Posted On2016-04-15