Incidental Mutation 'R4932:Mcm8'
ID380607
Institutional Source Beutler Lab
Gene Symbol Mcm8
Ensembl Gene ENSMUSG00000027353
Gene Nameminichromosome maintenance 8 homologous recombination repair factor
Synonyms5730432L01Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.810) question?
Stock #R4932 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location132816141-132844197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132838709 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 544 (M544I)
Ref Sequence ENSEMBL: ENSMUSP00000066842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028831] [ENSMUST00000066559]
Predicted Effect probably benign
Transcript: ENSMUST00000028831
AA Change: M572I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000028831
Gene: ENSMUSG00000027353
AA Change: M572I

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
Blast:MCM 79 155 2e-28 BLAST
MCM 198 742 2.42e-136 SMART
AAA 439 590 5.99e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066559
AA Change: M544I

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000066842
Gene: ENSMUSG00000027353
AA Change: M544I

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:MCM 51 127 2e-28 BLAST
MCM 170 714 2.42e-136 SMART
AAA 411 562 5.99e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the mini-chromosome maintenance proteins is a key component of the pre-replication complex and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein contains the central domain that is conserved among the mini-chromosome maintenance proteins. The encoded protein may interact with other mini-chromosome maintenance proteins and play a role in DNA replication. This gene may be associated with length of reproductive lifespan and menopause. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility associated with impaired ovarian development and arrested male meiosis, and impaired sensitivity to homologous recombination double-strand break repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,932,630 T121S possibly damaging Het
Abcf1 A T 17: 35,959,450 V616E possibly damaging Het
Adam21 A G 12: 81,558,918 V690A probably benign Het
Afg3l1 A T 8: 123,501,380 T635S probably damaging Het
Ahcyl2 T A 6: 29,890,701 M390K probably benign Het
Ank3 T A 10: 69,898,223 probably null Het
Arhgef3 A T 14: 27,384,213 K151N probably damaging Het
Ccr3 T G 9: 124,029,006 F126C probably damaging Het
Ccser1 A G 6: 61,718,191 D170G possibly damaging Het
Celsr2 T A 3: 108,402,758 D1552V probably damaging Het
Cfap69 G A 5: 5,625,820 L265F probably damaging Het
Chrna9 C T 5: 65,969,190 R92* probably null Het
Cog3 A T 14: 75,732,954 V341D probably damaging Het
Csmd1 C A 8: 16,023,765 R2072L probably damaging Het
Dbf4 G T 5: 8,398,039 H390Q probably benign Het
Dcaf4 T A 12: 83,532,304 C166S possibly damaging Het
Dclk3 T A 9: 111,468,042 L218Q possibly damaging Het
Dip2b T A 15: 100,171,722 W643R probably damaging Het
Dip2c A G 13: 9,623,972 K1091E probably damaging Het
Dis3 T A 14: 99,088,904 H415L probably damaging Het
Dnah7a T A 1: 53,503,578 I2478F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Doc2a T C 7: 126,848,580 probably benign Het
Dph5 A T 3: 115,899,807 M125L probably benign Het
Dst A T 1: 34,228,683 T5247S possibly damaging Het
Eno4 T G 19: 58,964,457 V477G possibly damaging Het
Exosc8 T C 3: 54,729,290 I207V possibly damaging Het
Fam173a T G 17: 25,791,678 probably null Het
Fat4 T A 3: 39,007,203 S4312T probably benign Het
Fgfr2 T C 7: 130,241,277 D126G probably damaging Het
Fgfr4 A G 13: 55,168,170 T799A unknown Het
Gcn1l1 A T 5: 115,592,144 D839V probably benign Het
Gprin3 A G 6: 59,354,173 V383A probably benign Het
Gpt T C 15: 76,698,840 V361A probably benign Het
Hepacam G A 9: 37,381,764 C217Y probably damaging Het
Hsp90aa1 A T 12: 110,693,717 Y382N probably damaging Het
Htr2a T A 14: 74,642,022 N30K probably benign Het
Jhy A T 9: 40,961,003 M70K possibly damaging Het
Lrrc19 T C 4: 94,640,937 Y36C probably damaging Het
Madcam1 C T 10: 79,665,613 Q171* probably null Het
Mdga1 C T 17: 29,857,606 G64E probably damaging Het
Mettl7a1 T A 15: 100,305,106 F87Y probably benign Het
Mmp3 A G 9: 7,446,994 D58G probably benign Het
Ms4a10 T C 19: 10,964,768 Y123C probably damaging Het
Ms4a4d T A 19: 11,557,932 I198K probably benign Het
Mthfd1l A T 10: 3,980,241 D112V probably benign Het
N4bp2l2 A C 5: 150,643,141 S567R probably benign Het
Ndufaf2 A G 13: 108,158,476 Y32H probably damaging Het
Nup153 T A 13: 46,712,737 K182* probably null Het
Olfr1186 A G 2: 88,525,735 T51A probably benign Het
Olfr481 T A 7: 108,081,574 V260E probably damaging Het
Olfr551 A G 7: 102,588,416 F109S probably damaging Het
Otoa T C 7: 121,155,135 S928P probably damaging Het
Oxct2a T C 4: 123,322,703 D295G probably benign Het
P4ha2 C A 11: 54,125,020 T411K probably benign Het
Plcg2 A T 8: 117,607,083 Q865L probably benign Het
Prepl G T 17: 85,078,504 T244K possibly damaging Het
Ptpro A T 6: 137,411,105 K776* probably null Het
Rc3h2 T C 2: 37,389,832 K462E possibly damaging Het
Scn10a A G 9: 119,687,874 probably null Het
Serpinb1c A G 13: 32,882,164 V266A probably damaging Het
Slc6a20b T A 9: 123,604,796 N326Y probably damaging Het
Spcs2 C T 7: 99,858,831 G16D possibly damaging Het
Spns3 T C 11: 72,499,495 D441G possibly damaging Het
Srsf4 A G 4: 131,891,245 D49G probably damaging Het
Tec A T 5: 72,760,393 C494* probably null Het
Tecpr1 A T 5: 144,204,658 Y798N probably damaging Het
Trim56 C T 5: 137,114,489 E58K probably damaging Het
Ttn A T 2: 76,796,134 D13146E probably damaging Het
Ube2q1 A T 3: 89,779,483 K46* probably null Het
Ucn G T 5: 31,138,498 T8K probably benign Het
Usp25 T C 16: 77,033,982 probably null Het
Usp48 A T 4: 137,615,833 Q430L probably benign Het
Usp48 A T 4: 137,615,834 probably null Het
Vill A T 9: 119,061,511 D164V probably damaging Het
Vmn2r91 T A 17: 18,136,489 M806K possibly damaging Het
Wdfy4 T A 14: 33,029,013 Y2256F probably damaging Het
Wsb1 A G 11: 79,251,000 S64P probably damaging Het
Zc3h11a C A 1: 133,624,612 V586F probably benign Het
Zc3h12d A G 10: 7,853,250 D126G probably damaging Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp442 T A 2: 150,409,715 H89L possibly damaging Het
Zfp82 T A 7: 30,056,887 probably null Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Other mutations in Mcm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Mcm8 APN 2 132827537 missense probably benign
IGL00479:Mcm8 APN 2 132817174 missense probably benign
IGL00573:Mcm8 APN 2 132832812 missense possibly damaging 0.94
IGL00847:Mcm8 APN 2 132819674 missense probably benign 0.29
IGL00978:Mcm8 APN 2 132821406 missense probably benign
IGL01390:Mcm8 APN 2 132838078 splice site probably benign
IGL01785:Mcm8 APN 2 132827948 missense probably benign 0.05
IGL01786:Mcm8 APN 2 132827948 missense probably benign 0.05
IGL02216:Mcm8 APN 2 132839529 missense probably damaging 1.00
IGL03191:Mcm8 APN 2 132821442 missense possibly damaging 0.68
madamina UTSW 2 132832854 missense probably damaging 1.00
R0329:Mcm8 UTSW 2 132819994 missense possibly damaging 0.64
R0330:Mcm8 UTSW 2 132819994 missense possibly damaging 0.64
R1520:Mcm8 UTSW 2 132839455 missense probably benign 0.39
R1771:Mcm8 UTSW 2 132843556 nonsense probably null
R1967:Mcm8 UTSW 2 132842742 missense probably benign
R2228:Mcm8 UTSW 2 132820121 missense possibly damaging 0.85
R2418:Mcm8 UTSW 2 132824738 missense probably benign
R4728:Mcm8 UTSW 2 132832854 missense probably damaging 1.00
R4827:Mcm8 UTSW 2 132823254 missense probably damaging 0.99
R4847:Mcm8 UTSW 2 132820003 missense probably benign 0.01
R4928:Mcm8 UTSW 2 132839479 missense probably benign 0.00
R4962:Mcm8 UTSW 2 132838769 missense probably damaging 1.00
R6044:Mcm8 UTSW 2 132831680 critical splice donor site probably null
R6081:Mcm8 UTSW 2 132828083 missense probably benign 0.00
R6650:Mcm8 UTSW 2 132821407 missense probably benign 0.01
R6685:Mcm8 UTSW 2 132842650 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGAGAAGCTACACATGC -3'
(R):5'- CAGAAGTATTTGAGTCTTGACTGAG -3'

Sequencing Primer
(F):5'- AGCTACACATGCTCAGTGTG -3'
(R):5'- TGAGTCTTGACTGAGCACAC -3'
Posted On2016-04-15