Incidental Mutation 'R4932:Zmynd8'
ID380609
Institutional Source Beutler Lab
Gene Symbol Zmynd8
Ensembl Gene ENSMUSG00000039671
Gene Namezinc finger, MYND-type containing 8
Synonyms2010005I16Rik, ZMYND8, RACK7, 1110013E22Rik, 3632413B07Rik, Prkcbp1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R4932 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165784152-165899016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165834951 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 249 (V249A)
Ref Sequence ENSEMBL: ENSMUSP00000120932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018050] [ENSMUST00000088113] [ENSMUST00000099084] [ENSMUST00000109262] [ENSMUST00000109266] [ENSMUST00000109269] [ENSMUST00000153655] [ENSMUST00000170272] [ENSMUST00000177633]
Predicted Effect probably benign
Transcript: ENSMUST00000018050
AA Change: V254A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000018050
Gene: ENSMUSG00000039671
AA Change: V254A

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 90 131 2.23e-11 SMART
BROMO 147 254 1.77e-17 SMART
Pfam:PWWP 275 349 4e-12 PFAM
Pfam:DUF3544 412 624 9.8e-112 PFAM
internal_repeat_2 640 701 9.06e-5 PROSPERO
low complexity region 770 805 N/A INTRINSIC
low complexity region 853 868 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
coiled coil region 916 978 N/A INTRINSIC
Pfam:zf-MYND 988 1022 2.2e-7 PFAM
low complexity region 1055 1075 N/A INTRINSIC
low complexity region 1142 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088113
AA Change: V249A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000085436
Gene: ENSMUSG00000039671
AA Change: V249A

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 271 346 2.7e-11 PFAM
Pfam:DUF3544 408 617 2.1e-102 PFAM
internal_repeat_2 635 696 4.2e-5 PROSPERO
low complexity region 765 800 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
coiled coil region 911 973 N/A INTRINSIC
low complexity region 1050 1070 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099084
AA Change: V229A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096683
Gene: ENSMUSG00000039671
AA Change: V229A

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 4.1e-12 PFAM
Pfam:DUF3544 387 599 1e-111 PFAM
internal_repeat_2 615 676 4.95e-5 PROSPERO
low complexity region 745 780 N/A INTRINSIC
low complexity region 819 844 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
coiled coil region 943 1005 N/A INTRINSIC
Pfam:zf-MYND 1015 1049 2.3e-7 PFAM
low complexity region 1082 1102 N/A INTRINSIC
low complexity region 1169 1183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109262
AA Change: V229A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104885
Gene: ENSMUSG00000039671
AA Change: V229A

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 1.2e-12 PFAM
Pfam:DUF3544 387 460 3.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109266
AA Change: V274A

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104889
Gene: ENSMUSG00000039671
AA Change: V274A

DomainStartEndE-ValueType
low complexity region 6 11 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 110 151 2.23e-11 SMART
BROMO 167 274 1.77e-17 SMART
Pfam:PWWP 295 369 4.1e-12 PFAM
Pfam:DUF3544 432 644 1e-111 PFAM
internal_repeat_2 660 721 8.36e-5 PROSPERO
low complexity region 790 825 N/A INTRINSIC
low complexity region 873 888 N/A INTRINSIC
low complexity region 895 907 N/A INTRINSIC
coiled coil region 936 998 N/A INTRINSIC
Pfam:zf-MYND 1008 1042 2.3e-7 PFAM
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1162 1176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109269
AA Change: V258A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104892
Gene: ENSMUSG00000039671
AA Change: V258A

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
PHD 94 135 2.23e-11 SMART
BROMO 151 258 1.77e-17 SMART
Pfam:PWWP 280 355 6.6e-11 PFAM
Pfam:DUF3544 417 626 2.6e-102 PFAM
internal_repeat_2 644 705 6.15e-5 PROSPERO
low complexity region 774 809 N/A INTRINSIC
low complexity region 848 873 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 931 943 N/A INTRINSIC
coiled coil region 972 1034 N/A INTRINSIC
low complexity region 1111 1131 N/A INTRINSIC
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152682
Predicted Effect possibly damaging
Transcript: ENSMUST00000153655
AA Change: V249A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120932
Gene: ENSMUSG00000039671
AA Change: V249A

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 270 344 3.5e-12 PFAM
Pfam:DUF3544 407 480 6.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170272
AA Change: V229A

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128680
Gene: ENSMUSG00000039671
AA Change: V229A

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 1.1e-11 PFAM
Pfam:DUF3544 387 599 1.9e-111 PFAM
internal_repeat_2 615 676 7.92e-5 PROSPERO
low complexity region 745 780 N/A INTRINSIC
low complexity region 828 843 N/A INTRINSIC
low complexity region 850 862 N/A INTRINSIC
coiled coil region 891 953 N/A INTRINSIC
Pfam:zf-MYND 963 997 1.1e-6 PFAM
low complexity region 1030 1050 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177633
AA Change: V249A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136211
Gene: ENSMUSG00000039671
AA Change: V249A

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 270 344 9.6e-12 PFAM
Pfam:DUF3544 407 619 1.8e-111 PFAM
internal_repeat_2 635 696 6.45e-5 PROSPERO
low complexity region 765 800 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
coiled coil region 911 973 N/A INTRINSIC
Pfam:zf-MYND 983 1017 6.7e-7 PFAM
low complexity region 1050 1070 N/A INTRINSIC
low complexity region 1137 1151 N/A INTRINSIC
Meta Mutation Damage Score 0.488 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for activated C-kinase (RACK) protein. The encoded protein has been shown to bind in vitro to activated protein kinase C beta I. In addition, this protein is a cutaneous T-cell lymphoma-associated antigen. Finally, the protein contains a bromodomain and two zinc fingers, and is thought to be a transcriptional regulator. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,932,630 T121S possibly damaging Het
Abcf1 A T 17: 35,959,450 V616E possibly damaging Het
Adam21 A G 12: 81,558,918 V690A probably benign Het
Afg3l1 A T 8: 123,501,380 T635S probably damaging Het
Ahcyl2 T A 6: 29,890,701 M390K probably benign Het
Ank3 T A 10: 69,898,223 probably null Het
Arhgef3 A T 14: 27,384,213 K151N probably damaging Het
Ccr3 T G 9: 124,029,006 F126C probably damaging Het
Ccser1 A G 6: 61,718,191 D170G possibly damaging Het
Celsr2 T A 3: 108,402,758 D1552V probably damaging Het
Cfap69 G A 5: 5,625,820 L265F probably damaging Het
Chrna9 C T 5: 65,969,190 R92* probably null Het
Cog3 A T 14: 75,732,954 V341D probably damaging Het
Csmd1 C A 8: 16,023,765 R2072L probably damaging Het
Dbf4 G T 5: 8,398,039 H390Q probably benign Het
Dcaf4 T A 12: 83,532,304 C166S possibly damaging Het
Dclk3 T A 9: 111,468,042 L218Q possibly damaging Het
Dip2b T A 15: 100,171,722 W643R probably damaging Het
Dip2c A G 13: 9,623,972 K1091E probably damaging Het
Dis3 T A 14: 99,088,904 H415L probably damaging Het
Dnah7a T A 1: 53,503,578 I2478F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Doc2a T C 7: 126,848,580 probably benign Het
Dph5 A T 3: 115,899,807 M125L probably benign Het
Dst A T 1: 34,228,683 T5247S possibly damaging Het
Eno4 T G 19: 58,964,457 V477G possibly damaging Het
Exosc8 T C 3: 54,729,290 I207V possibly damaging Het
Fam173a T G 17: 25,791,678 probably null Het
Fat4 T A 3: 39,007,203 S4312T probably benign Het
Fgfr2 T C 7: 130,241,277 D126G probably damaging Het
Fgfr4 A G 13: 55,168,170 T799A unknown Het
Gcn1l1 A T 5: 115,592,144 D839V probably benign Het
Gprin3 A G 6: 59,354,173 V383A probably benign Het
Gpt T C 15: 76,698,840 V361A probably benign Het
Hepacam G A 9: 37,381,764 C217Y probably damaging Het
Hsp90aa1 A T 12: 110,693,717 Y382N probably damaging Het
Htr2a T A 14: 74,642,022 N30K probably benign Het
Jhy A T 9: 40,961,003 M70K possibly damaging Het
Lrrc19 T C 4: 94,640,937 Y36C probably damaging Het
Madcam1 C T 10: 79,665,613 Q171* probably null Het
Mcm8 G A 2: 132,838,709 M544I probably benign Het
Mdga1 C T 17: 29,857,606 G64E probably damaging Het
Mettl7a1 T A 15: 100,305,106 F87Y probably benign Het
Mmp3 A G 9: 7,446,994 D58G probably benign Het
Ms4a10 T C 19: 10,964,768 Y123C probably damaging Het
Ms4a4d T A 19: 11,557,932 I198K probably benign Het
Mthfd1l A T 10: 3,980,241 D112V probably benign Het
N4bp2l2 A C 5: 150,643,141 S567R probably benign Het
Ndufaf2 A G 13: 108,158,476 Y32H probably damaging Het
Nup153 T A 13: 46,712,737 K182* probably null Het
Olfr1186 A G 2: 88,525,735 T51A probably benign Het
Olfr481 T A 7: 108,081,574 V260E probably damaging Het
Olfr551 A G 7: 102,588,416 F109S probably damaging Het
Otoa T C 7: 121,155,135 S928P probably damaging Het
Oxct2a T C 4: 123,322,703 D295G probably benign Het
P4ha2 C A 11: 54,125,020 T411K probably benign Het
Plcg2 A T 8: 117,607,083 Q865L probably benign Het
Prepl G T 17: 85,078,504 T244K possibly damaging Het
Ptpro A T 6: 137,411,105 K776* probably null Het
Rc3h2 T C 2: 37,389,832 K462E possibly damaging Het
Scn10a A G 9: 119,687,874 probably null Het
Serpinb1c A G 13: 32,882,164 V266A probably damaging Het
Slc6a20b T A 9: 123,604,796 N326Y probably damaging Het
Spcs2 C T 7: 99,858,831 G16D possibly damaging Het
Spns3 T C 11: 72,499,495 D441G possibly damaging Het
Srsf4 A G 4: 131,891,245 D49G probably damaging Het
Tec A T 5: 72,760,393 C494* probably null Het
Tecpr1 A T 5: 144,204,658 Y798N probably damaging Het
Trim56 C T 5: 137,114,489 E58K probably damaging Het
Ttn A T 2: 76,796,134 D13146E probably damaging Het
Ube2q1 A T 3: 89,779,483 K46* probably null Het
Ucn G T 5: 31,138,498 T8K probably benign Het
Usp25 T C 16: 77,033,982 probably null Het
Usp48 A T 4: 137,615,833 Q430L probably benign Het
Usp48 A T 4: 137,615,834 probably null Het
Vill A T 9: 119,061,511 D164V probably damaging Het
Vmn2r91 T A 17: 18,136,489 M806K possibly damaging Het
Wdfy4 T A 14: 33,029,013 Y2256F probably damaging Het
Wsb1 A G 11: 79,251,000 S64P probably damaging Het
Zc3h11a C A 1: 133,624,612 V586F probably benign Het
Zc3h12d A G 10: 7,853,250 D126G probably damaging Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp442 T A 2: 150,409,715 H89L possibly damaging Het
Zfp82 T A 7: 30,056,887 probably null Het
Other mutations in Zmynd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Zmynd8 APN 2 165812814 missense probably damaging 1.00
IGL01311:Zmynd8 APN 2 165805209 missense probably damaging 1.00
IGL02317:Zmynd8 APN 2 165820572 missense possibly damaging 0.92
IGL02548:Zmynd8 APN 2 165833405 missense probably damaging 1.00
IGL02798:Zmynd8 APN 2 165852150 critical splice acceptor site probably null
IGL02933:Zmynd8 APN 2 165828318 missense possibly damaging 0.65
F5770:Zmynd8 UTSW 2 165812394 nonsense probably null
I1329:Zmynd8 UTSW 2 165828225 missense probably damaging 1.00
P0031:Zmynd8 UTSW 2 165820698 splice site probably benign
R0267:Zmynd8 UTSW 2 165828402 missense probably damaging 1.00
R0608:Zmynd8 UTSW 2 165787158 splice site probably null
R1663:Zmynd8 UTSW 2 165807885 missense probably benign 0.11
R2212:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3412:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3413:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3749:Zmynd8 UTSW 2 165805198 missense probably damaging 1.00
R3820:Zmynd8 UTSW 2 165815461 nonsense probably null
R3836:Zmynd8 UTSW 2 165858099 missense probably benign 0.05
R3957:Zmynd8 UTSW 2 165812475 missense probably damaging 0.99
R4379:Zmynd8 UTSW 2 165807938 splice site probably null
R4526:Zmynd8 UTSW 2 165807607 intron probably benign
R4739:Zmynd8 UTSW 2 165805329 missense probably damaging 1.00
R4838:Zmynd8 UTSW 2 165840034 nonsense probably null
R4933:Zmynd8 UTSW 2 165834951 missense possibly damaging 0.90
R4997:Zmynd8 UTSW 2 165792816 missense probably benign 0.01
R5652:Zmynd8 UTSW 2 165807698 missense probably damaging 1.00
R5741:Zmynd8 UTSW 2 165840017 missense probably damaging 1.00
R6008:Zmynd8 UTSW 2 165842787 missense possibly damaging 0.77
R6242:Zmynd8 UTSW 2 165898947 missense possibly damaging 0.91
R6332:Zmynd8 UTSW 2 165838852 missense probably damaging 1.00
R6394:Zmynd8 UTSW 2 165846023 nonsense probably null
R6772:Zmynd8 UTSW 2 165807601 missense probably benign 0.35
R6970:Zmynd8 UTSW 2 165875750 missense probably damaging 1.00
R6986:Zmynd8 UTSW 2 165833415 missense probably damaging 1.00
V7580:Zmynd8 UTSW 2 165812394 nonsense probably null
V7581:Zmynd8 UTSW 2 165812394 nonsense probably null
V7583:Zmynd8 UTSW 2 165812394 nonsense probably null
Z1088:Zmynd8 UTSW 2 165828171 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGAGCTTCCCAGTCTCGTC -3'
(R):5'- TCTGCCTGCCCTGTAATACAAAAG -3'

Sequencing Primer
(F):5'- TCTCGTAAGTCCCCGGAGAG -3'
(R):5'- CAGCCTGGTCTACAAAGTGAGTTC -3'
Posted On2016-04-15