Incidental Mutation 'R4932:Cfap69'
ID380620
Institutional Source Beutler Lab
Gene Symbol Cfap69
Ensembl Gene ENSMUSG00000040473
Gene Namecilia and flagella associated protein 69
SynonymsA330021E22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R4932 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location5579278-5664239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5625820 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 265 (L265F)
Ref Sequence ENSEMBL: ENSMUSP00000143393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054865] [ENSMUST00000061008] [ENSMUST00000132510] [ENSMUST00000135252] [ENSMUST00000196165]
Predicted Effect probably damaging
Transcript: ENSMUST00000054865
AA Change: L265F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053206
Gene: ENSMUSG00000040473
AA Change: L265F

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 847 860 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000061008
AA Change: L265F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051741
Gene: ENSMUSG00000040473
AA Change: L265F

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132510
SMART Domains Protein: ENSMUSP00000122569
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135252
AA Change: L265F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117518
Gene: ENSMUSG00000040473
AA Change: L265F

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150140
Predicted Effect probably damaging
Transcript: ENSMUST00000196165
AA Change: L265F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143393
Gene: ENSMUSG00000040473
AA Change: L265F

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199314
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit faster response kinetics and stimuli integration to olfactory stimulation and impaired olfaction a buried food pellet test with a background of the same odor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,932,630 T121S possibly damaging Het
Abcf1 A T 17: 35,959,450 V616E possibly damaging Het
Adam21 A G 12: 81,558,918 V690A probably benign Het
Afg3l1 A T 8: 123,501,380 T635S probably damaging Het
Ahcyl2 T A 6: 29,890,701 M390K probably benign Het
Ank3 T A 10: 69,898,223 probably null Het
Arhgef3 A T 14: 27,384,213 K151N probably damaging Het
Ccr3 T G 9: 124,029,006 F126C probably damaging Het
Ccser1 A G 6: 61,718,191 D170G possibly damaging Het
Celsr2 T A 3: 108,402,758 D1552V probably damaging Het
Chrna9 C T 5: 65,969,190 R92* probably null Het
Cog3 A T 14: 75,732,954 V341D probably damaging Het
Csmd1 C A 8: 16,023,765 R2072L probably damaging Het
Dbf4 G T 5: 8,398,039 H390Q probably benign Het
Dcaf4 T A 12: 83,532,304 C166S possibly damaging Het
Dclk3 T A 9: 111,468,042 L218Q possibly damaging Het
Dip2b T A 15: 100,171,722 W643R probably damaging Het
Dip2c A G 13: 9,623,972 K1091E probably damaging Het
Dis3 T A 14: 99,088,904 H415L probably damaging Het
Dnah7a T A 1: 53,503,578 I2478F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Doc2a T C 7: 126,848,580 probably benign Het
Dph5 A T 3: 115,899,807 M125L probably benign Het
Dst A T 1: 34,228,683 T5247S possibly damaging Het
Eno4 T G 19: 58,964,457 V477G possibly damaging Het
Exosc8 T C 3: 54,729,290 I207V possibly damaging Het
Fam173a T G 17: 25,791,678 probably null Het
Fat4 T A 3: 39,007,203 S4312T probably benign Het
Fgfr2 T C 7: 130,241,277 D126G probably damaging Het
Fgfr4 A G 13: 55,168,170 T799A unknown Het
Gcn1l1 A T 5: 115,592,144 D839V probably benign Het
Gprin3 A G 6: 59,354,173 V383A probably benign Het
Gpt T C 15: 76,698,840 V361A probably benign Het
Hepacam G A 9: 37,381,764 C217Y probably damaging Het
Hsp90aa1 A T 12: 110,693,717 Y382N probably damaging Het
Htr2a T A 14: 74,642,022 N30K probably benign Het
Jhy A T 9: 40,961,003 M70K possibly damaging Het
Lrrc19 T C 4: 94,640,937 Y36C probably damaging Het
Madcam1 C T 10: 79,665,613 Q171* probably null Het
Mcm8 G A 2: 132,838,709 M544I probably benign Het
Mdga1 C T 17: 29,857,606 G64E probably damaging Het
Mettl7a1 T A 15: 100,305,106 F87Y probably benign Het
Mmp3 A G 9: 7,446,994 D58G probably benign Het
Ms4a10 T C 19: 10,964,768 Y123C probably damaging Het
Ms4a4d T A 19: 11,557,932 I198K probably benign Het
Mthfd1l A T 10: 3,980,241 D112V probably benign Het
N4bp2l2 A C 5: 150,643,141 S567R probably benign Het
Ndufaf2 A G 13: 108,158,476 Y32H probably damaging Het
Nup153 T A 13: 46,712,737 K182* probably null Het
Olfr1186 A G 2: 88,525,735 T51A probably benign Het
Olfr481 T A 7: 108,081,574 V260E probably damaging Het
Olfr551 A G 7: 102,588,416 F109S probably damaging Het
Otoa T C 7: 121,155,135 S928P probably damaging Het
Oxct2a T C 4: 123,322,703 D295G probably benign Het
P4ha2 C A 11: 54,125,020 T411K probably benign Het
Plcg2 A T 8: 117,607,083 Q865L probably benign Het
Prepl G T 17: 85,078,504 T244K possibly damaging Het
Ptpro A T 6: 137,411,105 K776* probably null Het
Rc3h2 T C 2: 37,389,832 K462E possibly damaging Het
Scn10a A G 9: 119,687,874 probably null Het
Serpinb1c A G 13: 32,882,164 V266A probably damaging Het
Slc6a20b T A 9: 123,604,796 N326Y probably damaging Het
Spcs2 C T 7: 99,858,831 G16D possibly damaging Het
Spns3 T C 11: 72,499,495 D441G possibly damaging Het
Srsf4 A G 4: 131,891,245 D49G probably damaging Het
Tec A T 5: 72,760,393 C494* probably null Het
Tecpr1 A T 5: 144,204,658 Y798N probably damaging Het
Trim56 C T 5: 137,114,489 E58K probably damaging Het
Ttn A T 2: 76,796,134 D13146E probably damaging Het
Ube2q1 A T 3: 89,779,483 K46* probably null Het
Ucn G T 5: 31,138,498 T8K probably benign Het
Usp25 T C 16: 77,033,982 probably null Het
Usp48 A T 4: 137,615,833 Q430L probably benign Het
Usp48 A T 4: 137,615,834 probably null Het
Vill A T 9: 119,061,511 D164V probably damaging Het
Vmn2r91 T A 17: 18,136,489 M806K possibly damaging Het
Wdfy4 T A 14: 33,029,013 Y2256F probably damaging Het
Wsb1 A G 11: 79,251,000 S64P probably damaging Het
Zc3h11a C A 1: 133,624,612 V586F probably benign Het
Zc3h12d A G 10: 7,853,250 D126G probably damaging Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp442 T A 2: 150,409,715 H89L possibly damaging Het
Zfp82 T A 7: 30,056,887 probably null Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Other mutations in Cfap69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cfap69 APN 5 5584682 missense probably damaging 1.00
IGL00234:Cfap69 APN 5 5617295 missense probably benign 0.03
IGL00658:Cfap69 APN 5 5625857 missense probably damaging 1.00
IGL00901:Cfap69 APN 5 5619162 splice site probably benign
IGL01410:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01415:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01839:Cfap69 APN 5 5626027 nonsense probably null
IGL01993:Cfap69 APN 5 5581284 missense probably damaging 0.99
IGL02821:Cfap69 APN 5 5664017 missense probably benign 0.01
IGL03212:Cfap69 APN 5 5657849 critical splice acceptor site probably null
IGL03339:Cfap69 APN 5 5586436 splice site probably benign
IGL03052:Cfap69 UTSW 5 5589206 missense probably damaging 0.97
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0387:Cfap69 UTSW 5 5589303 missense probably damaging 0.98
R0433:Cfap69 UTSW 5 5649853 missense probably damaging 0.99
R0690:Cfap69 UTSW 5 5663951 missense probably damaging 0.99
R0702:Cfap69 UTSW 5 5644465 missense probably benign 0.27
R0718:Cfap69 UTSW 5 5621924 missense probably damaging 1.00
R1525:Cfap69 UTSW 5 5640230 splice site probably null
R1670:Cfap69 UTSW 5 5586409 missense probably benign 0.27
R1677:Cfap69 UTSW 5 5582457 missense probably damaging 1.00
R1857:Cfap69 UTSW 5 5582518 missense possibly damaging 0.92
R1916:Cfap69 UTSW 5 5663970 missense probably damaging 0.99
R1937:Cfap69 UTSW 5 5593818 missense probably damaging 1.00
R2029:Cfap69 UTSW 5 5604306 missense probably damaging 1.00
R2106:Cfap69 UTSW 5 5595979 missense probably benign 0.05
R2177:Cfap69 UTSW 5 5625803 missense probably damaging 1.00
R2261:Cfap69 UTSW 5 5596018 missense probably damaging 0.99
R2939:Cfap69 UTSW 5 5644432 missense probably damaging 0.99
R3706:Cfap69 UTSW 5 5613843 nonsense probably null
R3876:Cfap69 UTSW 5 5584645 splice site probably benign
R3893:Cfap69 UTSW 5 5581245 missense probably damaging 1.00
R4033:Cfap69 UTSW 5 5604389 missense possibly damaging 0.87
R4760:Cfap69 UTSW 5 5646939 missense probably damaging 1.00
R4787:Cfap69 UTSW 5 5646934 critical splice donor site probably null
R5215:Cfap69 UTSW 5 5589133 missense possibly damaging 0.82
R5258:Cfap69 UTSW 5 5604271 splice site probably null
R5596:Cfap69 UTSW 5 5626020 missense probably damaging 1.00
R5673:Cfap69 UTSW 5 5596027 missense possibly damaging 0.66
R5752:Cfap69 UTSW 5 5589204 missense probably damaging 1.00
R5933:Cfap69 UTSW 5 5640183 missense probably damaging 1.00
R6148:Cfap69 UTSW 5 5663996 missense probably benign 0.03
R6511:Cfap69 UTSW 5 5617220 missense probably damaging 0.98
R6550:Cfap69 UTSW 5 5581220 missense probably benign 0.03
R6870:Cfap69 UTSW 5 5621958 missense probably benign 0.26
X0010:Cfap69 UTSW 5 5644503 splice site probably null
Predicted Primers PCR Primer
(F):5'- AATGCAGCCTTCAGATGAATCAG -3'
(R):5'- AAAGTCCTGCAGCATCTCTC -3'

Sequencing Primer
(F):5'- AGCCTTCAGATGAATCAGAATTTAAC -3'
(R):5'- AGCATCTCTCTACTTCTGGTGTG -3'
Posted On2016-04-15