Incidental Mutation 'R4932:Gcn1l1'
ID380625
Institutional Source Beutler Lab
Gene Symbol Gcn1l1
Ensembl Gene ENSMUSG00000041638
Gene NameGCN1 general control of amino-acid synthesis 1-like 1 (yeast)
SynonymsGCN1L, G431004K08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R4932 (G1)
Quality Score176
Status Not validated
Chromosome5
Chromosomal Location115565254-115622654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115592144 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 839 (D839V)
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
Predicted Effect probably benign
Transcript: ENSMUST00000064454
AA Change: D839V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: D839V

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125299
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,932,630 T121S possibly damaging Het
Abcf1 A T 17: 35,959,450 V616E possibly damaging Het
Adam21 A G 12: 81,558,918 V690A probably benign Het
Afg3l1 A T 8: 123,501,380 T635S probably damaging Het
Ahcyl2 T A 6: 29,890,701 M390K probably benign Het
Ank3 T A 10: 69,898,223 probably null Het
Arhgef3 A T 14: 27,384,213 K151N probably damaging Het
Ccr3 T G 9: 124,029,006 F126C probably damaging Het
Ccser1 A G 6: 61,718,191 D170G possibly damaging Het
Celsr2 T A 3: 108,402,758 D1552V probably damaging Het
Cfap69 G A 5: 5,625,820 L265F probably damaging Het
Chrna9 C T 5: 65,969,190 R96* probably null Het
Cog3 A T 14: 75,732,954 V351D probably damaging Het
Csmd1 C A 8: 16,023,765 R2072L probably damaging Het
Dbf4 G T 5: 8,398,039 H390Q probably benign Het
Dcaf4 T A 12: 83,532,304 C166S possibly damaging Het
Dclk3 T A 9: 111,468,042 L218Q possibly damaging Het
Dip2b T A 15: 100,171,722 W643R probably damaging Het
Dip2c A G 13: 9,623,972 K1091E probably damaging Het
Dis3 T A 14: 99,088,904 H415L probably damaging Het
Dnah7a T A 1: 53,503,578 I2478F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Doc2a T C 7: 126,848,580 probably benign Het
Dph5 A T 3: 115,899,807 M125L probably benign Het
Dst A T 1: 34,228,683 T5247S possibly damaging Het
Eno4 T G 19: 58,964,457 V477G possibly damaging Het
Exosc8 T C 3: 54,729,290 I207V possibly damaging Het
Fam173a T G 17: 25,791,678 probably null Het
Fat4 T A 3: 39,007,203 S4312T probably benign Het
Fgfr2 T C 7: 130,241,277 D126G probably damaging Het
Fgfr4 A G 13: 55,168,170 T799A unknown Het
Gprin3 A G 6: 59,354,173 V383A probably benign Het
Gpt T C 15: 76,698,840 V361A probably benign Het
Hepacam G A 9: 37,381,764 C217Y probably damaging Het
Hsp90aa1 A T 12: 110,693,717 Y382N probably damaging Het
Htr2a T A 14: 74,642,022 N30K probably benign Het
Jhy A T 9: 40,961,003 M70K possibly damaging Het
Lrrc19 T C 4: 94,640,937 Y36C probably damaging Het
Madcam1 C T 10: 79,665,613 Q171* probably null Het
Mcm8 G A 2: 132,838,709 M544I probably benign Het
Mdga1 C T 17: 29,857,606 G338E probably damaging Het
Mettl7a1 T A 15: 100,305,106 F87Y probably benign Het
Mmp3 A G 9: 7,446,994 D58G probably benign Het
Ms4a10 T C 19: 10,964,768 Y123C probably damaging Het
Ms4a4d T A 19: 11,557,932 I198K probably benign Het
Mthfd1l A T 10: 3,980,241 D112V probably benign Het
N4bp2l2 A C 5: 150,643,141 S567R probably benign Het
Ndufaf2 A G 13: 108,158,476 Y32H probably damaging Het
Nup153 T A 13: 46,712,737 K251* probably null Het
Olfr1186 A G 2: 88,525,735 T51A probably benign Het
Olfr481 T A 7: 108,081,574 V260E probably damaging Het
Olfr551 A G 7: 102,588,416 F109S probably damaging Het
Otoa T C 7: 121,155,135 S928P probably damaging Het
Oxct2a T C 4: 123,322,703 D295G probably benign Het
P4ha2 C A 11: 54,125,020 T411K probably benign Het
Plcg2 A T 8: 117,607,083 Q865L probably benign Het
Prepl G T 17: 85,078,504 T244K possibly damaging Het
Ptpro A T 6: 137,411,105 K776* probably null Het
Rc3h2 T C 2: 37,389,832 K462E possibly damaging Het
Scn10a A G 9: 119,687,874 probably null Het
Serpinb1c A G 13: 32,882,164 V266A probably damaging Het
Slc6a20b T A 9: 123,604,796 N326Y probably damaging Het
Spcs2 C T 7: 99,858,831 G16D possibly damaging Het
Spns3 T C 11: 72,499,495 D441G possibly damaging Het
Srsf4 A G 4: 131,891,245 D49G probably damaging Het
Tec A T 5: 72,760,393 C494* probably null Het
Tecpr1 A T 5: 144,204,658 Y798N probably damaging Het
Trim56 C T 5: 137,114,489 E58K probably damaging Het
Ttn A T 2: 76,796,134 D13146E probably damaging Het
Ube2q1 A T 3: 89,779,483 K215* probably null Het
Ucn G T 5: 31,138,498 T8K probably benign Het
Usp25 T C 16: 77,033,982 probably null Het
Usp48 A T 4: 137,615,833 Q430L probably benign Het
Usp48 A T 4: 137,615,834 Q430H probably null Het
Vill A T 9: 119,061,511 D164V probably damaging Het
Vmn2r91 T A 17: 18,136,489 M806K possibly damaging Het
Wdfy4 T A 14: 33,029,013 Y2256F probably damaging Het
Wsb1 A G 11: 79,251,000 S64P probably damaging Het
Zc3h11a C A 1: 133,624,612 V586F probably benign Het
Zc3h12d A G 10: 7,853,250 D126G probably damaging Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp442 T A 2: 150,409,715 H89L possibly damaging Het
Zfp82 T A 7: 30,056,887 K287* probably null Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Other mutations in Gcn1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1l1 APN 5 115588143 unclassified probably benign
IGL00974:Gcn1l1 APN 5 115613793 missense possibly damaging 0.88
IGL01566:Gcn1l1 APN 5 115611058 missense probably damaging 1.00
IGL01843:Gcn1l1 APN 5 115619700 missense probably damaging 1.00
IGL01885:Gcn1l1 APN 5 115576115 unclassified probably null
IGL02081:Gcn1l1 APN 5 115585871 missense probably damaging 1.00
IGL02118:Gcn1l1 APN 5 115610879 missense probably damaging 1.00
IGL02150:Gcn1l1 APN 5 115609868 missense probably damaging 1.00
IGL02190:Gcn1l1 APN 5 115614124 missense probably damaging 1.00
IGL02219:Gcn1l1 APN 5 115613767 missense possibly damaging 0.68
IGL02507:Gcn1l1 APN 5 115585881 missense probably benign 0.11
IGL02644:Gcn1l1 APN 5 115575191 missense probably benign
IGL02678:Gcn1l1 APN 5 115613755 missense probably damaging 0.99
IGL02748:Gcn1l1 APN 5 115610800 unclassified probably null
IGL02755:Gcn1l1 APN 5 115604006 unclassified probably null
IGL02896:Gcn1l1 APN 5 115619648 unclassified probably benign
IGL03147:Gcn1l1 UTSW 5 115610858 missense possibly damaging 0.78
R0362:Gcn1l1 UTSW 5 115576108 splice site probably benign
R0540:Gcn1l1 UTSW 5 115588956 missense probably benign 0.00
R0569:Gcn1l1 UTSW 5 115595059 missense probably benign 0.00
R0570:Gcn1l1 UTSW 5 115592421 missense probably damaging 1.00
R0584:Gcn1l1 UTSW 5 115595015 missense probably damaging 1.00
R0630:Gcn1l1 UTSW 5 115581089 missense probably benign 0.06
R0656:Gcn1l1 UTSW 5 115589303 missense probably benign 0.27
R0801:Gcn1l1 UTSW 5 115591006 missense probably benign 0.12
R0890:Gcn1l1 UTSW 5 115579793 missense possibly damaging 0.77
R1400:Gcn1l1 UTSW 5 115614161 missense probably damaging 1.00
R1485:Gcn1l1 UTSW 5 115574617 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1673:Gcn1l1 UTSW 5 115582297 missense probably benign
R1894:Gcn1l1 UTSW 5 115589115 missense probably damaging 1.00
R2114:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2116:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2117:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2152:Gcn1l1 UTSW 5 115609829 missense probably benign 0.07
R2162:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R2216:Gcn1l1 UTSW 5 115593661 missense probably benign
R2218:Gcn1l1 UTSW 5 115619661 missense probably benign 0.04
R2278:Gcn1l1 UTSW 5 115611175 missense probably damaging 1.00
R2280:Gcn1l1 UTSW 5 115612730 missense probably damaging 1.00
R3719:Gcn1l1 UTSW 5 115579817 missense probably benign 0.03
R3729:Gcn1l1 UTSW 5 115583394 splice site probably benign
R3833:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R3932:Gcn1l1 UTSW 5 115587834 missense probably benign 0.11
R4067:Gcn1l1 UTSW 5 115599088 missense probably damaging 1.00
R4152:Gcn1l1 UTSW 5 115613354 critical splice acceptor site probably null
R4179:Gcn1l1 UTSW 5 115588050 missense probably benign 0.00
R4292:Gcn1l1 UTSW 5 115576148 missense possibly damaging 0.49
R4350:Gcn1l1 UTSW 5 115603330 missense probably damaging 1.00
R4493:Gcn1l1 UTSW 5 115594144 missense probably benign
R4672:Gcn1l1 UTSW 5 115606520 missense probably damaging 1.00
R4749:Gcn1l1 UTSW 5 115614402 missense probably benign
R4753:Gcn1l1 UTSW 5 115616478 missense probably benign
R4826:Gcn1l1 UTSW 5 115593693 missense probably benign
R4873:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4875:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4992:Gcn1l1 UTSW 5 115599166 missense probably benign 0.29
R5049:Gcn1l1 UTSW 5 115606671 missense probably damaging 1.00
R5211:Gcn1l1 UTSW 5 115619312 missense probably benign 0.04
R5226:Gcn1l1 UTSW 5 115588067 missense probably benign 0.01
R5338:Gcn1l1 UTSW 5 115583403 missense probably benign 0.00
R5914:Gcn1l1 UTSW 5 115610135 missense silent
R5932:Gcn1l1 UTSW 5 115592376 missense possibly damaging 0.77
R6422:Gcn1l1 UTSW 5 115609544 missense probably damaging 1.00
R6435:Gcn1l1 UTSW 5 115611022 critical splice acceptor site probably null
R6607:Gcn1l1 UTSW 5 115609478 missense probably damaging 0.98
R6724:Gcn1l1 UTSW 5 115609158 intron probably null
R6861:Gcn1l1 UTSW 5 115611049 missense probably benign
R6875:Gcn1l1 UTSW 5 115588110 missense probably damaging 1.00
R6910:Gcn1l1 UTSW 5 115606538 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GAGGCTGGCTTACAATTCTGG -3'
(R):5'- TACTGAATCAGGCCACACGG -3'

Sequencing Primer
(F):5'- GCCTGTGGATGTAGAACT -3'
(R):5'- ATGGCATCTAGTAGTCCAAGTGCC -3'
Posted On2016-04-15