Incidental Mutation 'R0399:Tpbg'
ID38064
Institutional Source Beutler Lab
Gene Symbol Tpbg
Ensembl Gene ENSMUSG00000035274
Gene Nametrophoblast glycoprotein
Synonyms5T4 oncofetal antigen, 5T4
MMRRC Submission 038604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R0399 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location85842380-85847040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85844938 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 320 (V320E)
Ref Sequence ENSEMBL: ENSMUSP00000096101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006559] [ENSMUST00000098500]
Predicted Effect probably benign
Transcript: ENSMUST00000006559
AA Change: V320E

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000006559
Gene: ENSMUSG00000035274
AA Change: V320E

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 61 95 1.27e-6 SMART
LRR 94 113 1.53e2 SMART
LRR_TYP 117 140 1.92e-2 SMART
LRR_TYP 141 164 6.88e-4 SMART
LRR 215 238 6.22e0 SMART
LRR_TYP 239 262 2.2e-2 SMART
LRR 263 286 2.67e-1 SMART
LRRCT 300 351 9.1e-14 SMART
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069896
SMART Domains Protein: ENSMUSP00000126873
Gene: ENSMUSG00000056031

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 68 88 N/A INTRINSIC
low complexity region 103 122 N/A INTRINSIC
low complexity region 150 193 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098500
AA Change: V320E

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096101
Gene: ENSMUSG00000035274
AA Change: V320E

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 61 95 1.27e-6 SMART
LRR 94 113 1.53e2 SMART
LRR_TYP 117 140 1.92e-2 SMART
LRR_TYP 141 164 6.88e-4 SMART
LRR 215 238 6.22e0 SMART
LRR_TYP 239 262 2.2e-2 SMART
LRR 263 286 2.67e-1 SMART
LRRCT 300 351 9.1e-14 SMART
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189191
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich transmembrane glycoprotein that may be involved in cell adhesion. The encoded protein is an oncofetal antigen that is specific to trophoblast cells. In adults this protein is highly expressed in many tumor cells and is associated with poor clinical outcome in numerous cancers. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit low penetrance hydrocephaly and premature death. Embryonic stem cells isolated from these mice exhibit impaired mesenchyme differentiation and reduced chemotaxis following differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,959 probably benign Het
6030452D12Rik T C 8: 106,504,542 M120T unknown Het
Actr1a A T 19: 46,385,011 probably null Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Anapc5 A T 5: 122,791,753 V555D probably damaging Het
Aox1 A G 1: 58,068,849 probably null Het
Arhgap30 A G 1: 171,404,816 E343G probably damaging Het
Asap2 C T 12: 21,217,997 T291I possibly damaging Het
Atp5a1 T A 18: 77,781,836 Y439* probably null Het
Auts2 A T 5: 131,440,524 S428T probably benign Het
B3gnt7 T A 1: 86,305,711 C109* probably null Het
C4b C A 17: 34,728,869 Q1657H probably damaging Het
Cadm2 A T 16: 66,747,339 L268* probably null Het
Cep290 G A 10: 100,554,400 probably benign Het
Cep68 T G 11: 20,230,571 I687L probably benign Het
Chd6 T A 2: 161,052,688 D84V probably damaging Het
Clpx A G 9: 65,322,769 T514A probably benign Het
Cox18 A T 5: 90,215,028 C324S probably benign Het
Cryzl2 T C 1: 157,462,016 Y75H probably damaging Het
Cxcr6 C T 9: 123,810,951 A339V possibly damaging Het
Dock1 T C 7: 135,163,442 L1721P probably benign Het
Dstyk T C 1: 132,453,080 probably benign Het
Ehf A G 2: 103,266,870 Y246H probably damaging Het
Epas1 T C 17: 86,805,193 V73A probably benign Het
Filip1 A G 9: 79,818,310 I1009T possibly damaging Het
Glis3 A T 19: 28,298,768 probably benign Het
Gm17333 A T 16: 77,852,790 noncoding transcript Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Gpr155 A T 2: 73,370,002 I387N possibly damaging Het
Gria1 A G 11: 57,186,027 D83G probably damaging Het
Grid2 A G 6: 64,666,052 I933V probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hook2 A G 8: 84,993,567 probably benign Het
Ift140 T A 17: 25,050,340 S656R possibly damaging Het
Il11ra1 A T 4: 41,766,185 T241S probably benign Het
Kank1 A G 19: 25,411,242 I760V probably benign Het
Kansl1 T C 11: 104,424,132 E360G possibly damaging Het
Klf9 A T 19: 23,142,082 S110C probably damaging Het
Klhl31 A G 9: 77,650,653 N217S probably benign Het
Lct T C 1: 128,300,525 Y1077C probably damaging Het
Lrrc49 A T 9: 60,610,246 probably benign Het
Lrrn1 T A 6: 107,569,120 H626Q probably benign Het
Mmp28 A T 11: 83,451,732 L40Q probably damaging Het
Mroh1 C T 15: 76,452,099 A1530V probably benign Het
Myo1e A G 9: 70,301,793 probably benign Het
Naa25 A T 5: 121,435,490 M761L probably benign Het
Ncln G A 10: 81,488,297 A465V probably damaging Het
Nktr A G 9: 121,731,484 N98S probably damaging Het
Olfr1012 T C 2: 85,759,904 I157M possibly damaging Het
Olfr215 C A 6: 116,582,781 S55I probably benign Het
Olfr651 T A 7: 104,553,369 V150E probably benign Het
Olfr76 G C 19: 12,120,370 A114G possibly damaging Het
Olfr878 G T 9: 37,919,553 A304S possibly damaging Het
Pacsin2 T C 15: 83,386,782 Y222C probably damaging Het
Pcdhb15 C T 18: 37,474,168 T151M possibly damaging Het
Plcz1 C A 6: 140,023,230 V161L possibly damaging Het
Ppp6c G A 2: 39,200,124 probably benign Het
Rhbdf2 T A 11: 116,603,992 Y286F probably benign Het
Rtn3 A T 19: 7,457,876 D231E probably damaging Het
Slc35c2 A C 2: 165,280,895 Y156* probably null Het
Spata46 A G 1: 170,311,537 D35G probably damaging Het
Tmed3 A G 9: 89,702,873 F110L possibly damaging Het
Tmem104 T G 11: 115,201,308 probably benign Het
Trib2 T C 12: 15,793,663 D190G probably damaging Het
Tspan2 A G 3: 102,759,385 T26A probably damaging Het
Usp17lb A C 7: 104,841,151 Y190D possibly damaging Het
Utp18 C T 11: 93,880,147 probably benign Het
Utp20 A T 10: 88,820,979 D121E probably damaging Het
Vmn1r80 T A 7: 12,193,317 M118K possibly damaging Het
Vmn1r84 T C 7: 12,361,867 S300G probably benign Het
Other mutations in Tpbg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Tpbg APN 9 85844092 missense unknown
IGL01789:Tpbg APN 9 85844901 missense probably benign 0.00
IGL01987:Tpbg APN 9 85845199 missense probably damaging 1.00
R0418:Tpbg UTSW 9 85844750 nonsense probably null
R0904:Tpbg UTSW 9 85844564 missense unknown
R1748:Tpbg UTSW 9 85844376 missense probably damaging 1.00
R3744:Tpbg UTSW 9 85845162 missense probably damaging 1.00
R3836:Tpbg UTSW 9 85843114 intron probably benign
R3837:Tpbg UTSW 9 85843114 intron probably benign
R3839:Tpbg UTSW 9 85843114 intron probably benign
R5221:Tpbg UTSW 9 85844425 missense probably damaging 1.00
R6488:Tpbg UTSW 9 85844485 missense possibly damaging 0.70
R7192:Tpbg UTSW 9 85844032 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATTCCCTGGTGAGCCTGACCTAC -3'
(R):5'- ACCTCATGCAGAGTCCTCCTTGAC -3'

Sequencing Primer
(F):5'- TGAGCCTGACCTACGCATC -3'
(R):5'- TTCTCAGACATCCGAGTTGGAAC -3'
Posted On2013-05-23