Incidental Mutation 'R4932:Mmp3'
ID380644
Institutional Source Beutler Lab
Gene Symbol Mmp3
Ensembl Gene ENSMUSG00000043613
Gene Namematrix metallopeptidase 3
SynonymsStmy1, Str1, stromelysin 1, SLN-1, stromelysin-1, STR-1, progelatinase, SLN1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4932 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location7445822-7455975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7446994 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 58 (D58G)
Ref Sequence ENSEMBL: ENSMUSP00000034497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034497]
Predicted Effect probably benign
Transcript: ENSMUST00000034497
AA Change: D58G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034497
Gene: ENSMUSG00000043613
AA Change: D58G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:PG_binding_1 29 89 1.7e-12 PFAM
ZnMc 107 267 6.24e-65 SMART
HX 298 340 4.56e-9 SMART
HX 342 385 2.87e-6 SMART
HX 390 437 4.73e-16 SMART
HX 439 479 3.3e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded protein is activated by the removal of an N-temrinal activation peptide to generate a zinc-dependent endopeptidase with a broad range of substrates such as proteoglycans, laminin, fibronectin, elastin, and collagens. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disrutptions in this gene display abnormalities of the immune system as well as minor structural abnormalities in the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,932,630 T121S possibly damaging Het
Abcf1 A T 17: 35,959,450 V616E possibly damaging Het
Adam21 A G 12: 81,558,918 V690A probably benign Het
Afg3l1 A T 8: 123,501,380 T635S probably damaging Het
Ahcyl2 T A 6: 29,890,701 M390K probably benign Het
Ank3 T A 10: 69,898,223 probably null Het
Arhgef3 A T 14: 27,384,213 K151N probably damaging Het
Ccr3 T G 9: 124,029,006 F126C probably damaging Het
Ccser1 A G 6: 61,718,191 D170G possibly damaging Het
Celsr2 T A 3: 108,402,758 D1552V probably damaging Het
Cfap69 G A 5: 5,625,820 L265F probably damaging Het
Chrna9 C T 5: 65,969,190 R96* probably null Het
Cog3 A T 14: 75,732,954 V351D probably damaging Het
Csmd1 C A 8: 16,023,765 R2072L probably damaging Het
Dbf4 G T 5: 8,398,039 H390Q probably benign Het
Dcaf4 T A 12: 83,532,304 C166S possibly damaging Het
Dclk3 T A 9: 111,468,042 L218Q possibly damaging Het
Dip2b T A 15: 100,171,722 W643R probably damaging Het
Dip2c A G 13: 9,623,972 K1091E probably damaging Het
Dis3 T A 14: 99,088,904 H415L probably damaging Het
Dnah7a T A 1: 53,503,578 I2478F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Doc2a T C 7: 126,848,580 probably benign Het
Dph5 A T 3: 115,899,807 M125L probably benign Het
Dst A T 1: 34,228,683 T5247S possibly damaging Het
Eno4 T G 19: 58,964,457 V477G possibly damaging Het
Exosc8 T C 3: 54,729,290 I207V possibly damaging Het
Fam173a T G 17: 25,791,678 probably null Het
Fat4 T A 3: 39,007,203 S4312T probably benign Het
Fgfr2 T C 7: 130,241,277 D126G probably damaging Het
Fgfr4 A G 13: 55,168,170 T799A unknown Het
Gcn1l1 A T 5: 115,592,144 D839V probably benign Het
Gprin3 A G 6: 59,354,173 V383A probably benign Het
Gpt T C 15: 76,698,840 V361A probably benign Het
Hepacam G A 9: 37,381,764 C217Y probably damaging Het
Hsp90aa1 A T 12: 110,693,717 Y382N probably damaging Het
Htr2a T A 14: 74,642,022 N30K probably benign Het
Jhy A T 9: 40,961,003 M70K possibly damaging Het
Lrrc19 T C 4: 94,640,937 Y36C probably damaging Het
Madcam1 C T 10: 79,665,613 Q171* probably null Het
Mcm8 G A 2: 132,838,709 M544I probably benign Het
Mdga1 C T 17: 29,857,606 G338E probably damaging Het
Mettl7a1 T A 15: 100,305,106 F87Y probably benign Het
Ms4a10 T C 19: 10,964,768 Y123C probably damaging Het
Ms4a4d T A 19: 11,557,932 I198K probably benign Het
Mthfd1l A T 10: 3,980,241 D112V probably benign Het
N4bp2l2 A C 5: 150,643,141 S567R probably benign Het
Ndufaf2 A G 13: 108,158,476 Y32H probably damaging Het
Nup153 T A 13: 46,712,737 K251* probably null Het
Olfr1186 A G 2: 88,525,735 T51A probably benign Het
Olfr481 T A 7: 108,081,574 V260E probably damaging Het
Olfr551 A G 7: 102,588,416 F109S probably damaging Het
Otoa T C 7: 121,155,135 S928P probably damaging Het
Oxct2a T C 4: 123,322,703 D295G probably benign Het
P4ha2 C A 11: 54,125,020 T411K probably benign Het
Plcg2 A T 8: 117,607,083 Q865L probably benign Het
Prepl G T 17: 85,078,504 T244K possibly damaging Het
Ptpro A T 6: 137,411,105 K776* probably null Het
Rc3h2 T C 2: 37,389,832 K462E possibly damaging Het
Scn10a A G 9: 119,687,874 probably null Het
Serpinb1c A G 13: 32,882,164 V266A probably damaging Het
Slc6a20b T A 9: 123,604,796 N326Y probably damaging Het
Spcs2 C T 7: 99,858,831 G16D possibly damaging Het
Spns3 T C 11: 72,499,495 D441G possibly damaging Het
Srsf4 A G 4: 131,891,245 D49G probably damaging Het
Tec A T 5: 72,760,393 C494* probably null Het
Tecpr1 A T 5: 144,204,658 Y798N probably damaging Het
Trim56 C T 5: 137,114,489 E58K probably damaging Het
Ttn A T 2: 76,796,134 D13146E probably damaging Het
Ube2q1 A T 3: 89,779,483 K215* probably null Het
Ucn G T 5: 31,138,498 T8K probably benign Het
Usp25 T C 16: 77,033,982 probably null Het
Usp48 A T 4: 137,615,833 Q430L probably benign Het
Usp48 A T 4: 137,615,834 Q430H probably null Het
Vill A T 9: 119,061,511 D164V probably damaging Het
Vmn2r91 T A 17: 18,136,489 M806K possibly damaging Het
Wdfy4 T A 14: 33,029,013 Y2256F probably damaging Het
Wsb1 A G 11: 79,251,000 S64P probably damaging Het
Zc3h11a C A 1: 133,624,612 V586F probably benign Het
Zc3h12d A G 10: 7,853,250 D126G probably damaging Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp442 T A 2: 150,409,715 H89L possibly damaging Het
Zfp82 T A 7: 30,056,887 K287* probably null Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Other mutations in Mmp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Mmp3 APN 9 7445894 utr 5 prime probably benign
IGL01738:Mmp3 APN 9 7446946 missense possibly damaging 0.94
IGL02154:Mmp3 APN 9 7453662 missense probably benign 0.19
IGL02212:Mmp3 APN 9 7450165 missense probably damaging 1.00
IGL02568:Mmp3 APN 9 7446001 missense probably benign 0.02
IGL03366:Mmp3 APN 9 7450149 missense probably benign 0.00
R0047:Mmp3 UTSW 9 7451910 splice donor site probably benign
R0047:Mmp3 UTSW 9 7451910 splice site probably benign
R0356:Mmp3 UTSW 9 7451768 missense probably benign 0.03
R0390:Mmp3 UTSW 9 7451320 missense probably benign 0.29
R0401:Mmp3 UTSW 9 7449790 missense probably damaging 1.00
R0466:Mmp3 UTSW 9 7450165 missense probably damaging 1.00
R0549:Mmp3 UTSW 9 7455638 missense probably benign 0.08
R0903:Mmp3 UTSW 9 7445994 missense probably benign 0.00
R1438:Mmp3 UTSW 9 7453705 missense probably benign 0.22
R1498:Mmp3 UTSW 9 7446967 missense possibly damaging 0.95
R1515:Mmp3 UTSW 9 7451232 missense probably benign 0.01
R1629:Mmp3 UTSW 9 7447641 missense probably benign 0.00
R1844:Mmp3 UTSW 9 7453662 missense probably benign 0.19
R1858:Mmp3 UTSW 9 7451799 missense probably benign 0.08
R2099:Mmp3 UTSW 9 7453672 missense probably benign 0.01
R2497:Mmp3 UTSW 9 7450131 missense probably benign 0.00
R2571:Mmp3 UTSW 9 7451844 missense possibly damaging 0.95
R4659:Mmp3 UTSW 9 7453673 missense probably benign 0.00
R4687:Mmp3 UTSW 9 7451223 missense probably benign 0.03
R4717:Mmp3 UTSW 9 7449881 missense possibly damaging 0.94
R4930:Mmp3 UTSW 9 7447640 missense probably benign 0.02
R5020:Mmp3 UTSW 9 7445984 missense probably benign
R5384:Mmp3 UTSW 9 7451759 nonsense probably null
R5385:Mmp3 UTSW 9 7451759 nonsense probably null
R5408:Mmp3 UTSW 9 7449904 missense probably damaging 0.98
R6268:Mmp3 UTSW 9 7447622 missense possibly damaging 0.78
X0022:Mmp3 UTSW 9 7449857 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CCCCTTGAAGTCATTGTTTTAATGG -3'
(R):5'- GATTTCCTCCATTTTGGCGAAC -3'

Sequencing Primer
(F):5'- AAAGTAAGTGTCTGTCAGGCTC -3'
(R):5'- CCATTTTGGCGAACCTGGGAAG -3'
Posted OnApr 15, 2016