Incidental Mutation 'R4932:Vill'
ID380651
Institutional Source Beutler Lab
Gene Symbol Vill
Ensembl Gene ENSMUSG00000038775
Gene Namevillin-like
SynonymsVillp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4932 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119052778-119071525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119061511 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 164 (D164V)
Ref Sequence ENSEMBL: ENSMUSP00000074294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000131647] [ENSMUST00000136561] [ENSMUST00000141185]
Predicted Effect probably damaging
Transcript: ENSMUST00000051386
AA Change: D164V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: D164V

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
GEL 613 706 7.8e-16 SMART
VHP 824 859 2.12e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074734
AA Change: D164V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: D164V

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
VHP 740 775 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126251
SMART Domains Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
Blast:GEL 1 56 9e-21 BLAST
GEL 63 149 4.38e-19 SMART
GEL 168 261 7.8e-16 SMART
VHP 357 392 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131647
SMART Domains Protein: ENSMUSP00000118375
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
SCOP:d1d4xg_ 7 85 6e-23 SMART
Blast:GEL 14 85 1e-48 BLAST
PDB:2VIL|A 15 82 1e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135872
Predicted Effect probably benign
Transcript: ENSMUST00000136561
SMART Domains Protein: ENSMUSP00000123393
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 1 96 2.46e-13 SMART
Blast:GEL 116 140 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141185
SMART Domains Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 7 104 7.92e-17 SMART
GEL 124 210 4.38e-19 SMART
GEL 229 322 7.8e-16 SMART
VHP 440 475 2.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153630
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,932,630 T121S possibly damaging Het
Abcf1 A T 17: 35,959,450 V616E possibly damaging Het
Adam21 A G 12: 81,558,918 V690A probably benign Het
Afg3l1 A T 8: 123,501,380 T635S probably damaging Het
Ahcyl2 T A 6: 29,890,701 M390K probably benign Het
Ank3 T A 10: 69,898,223 probably null Het
Arhgef3 A T 14: 27,384,213 K151N probably damaging Het
Ccr3 T G 9: 124,029,006 F126C probably damaging Het
Ccser1 A G 6: 61,718,191 D170G possibly damaging Het
Celsr2 T A 3: 108,402,758 D1552V probably damaging Het
Cfap69 G A 5: 5,625,820 L265F probably damaging Het
Chrna9 C T 5: 65,969,190 R96* probably null Het
Cog3 A T 14: 75,732,954 V351D probably damaging Het
Csmd1 C A 8: 16,023,765 R2072L probably damaging Het
Dbf4 G T 5: 8,398,039 H390Q probably benign Het
Dcaf4 T A 12: 83,532,304 C166S possibly damaging Het
Dclk3 T A 9: 111,468,042 L218Q possibly damaging Het
Dip2b T A 15: 100,171,722 W643R probably damaging Het
Dip2c A G 13: 9,623,972 K1091E probably damaging Het
Dis3 T A 14: 99,088,904 H415L probably damaging Het
Dnah7a T A 1: 53,503,578 I2478F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Doc2a T C 7: 126,848,580 probably benign Het
Dph5 A T 3: 115,899,807 M125L probably benign Het
Dst A T 1: 34,228,683 T5247S possibly damaging Het
Eno4 T G 19: 58,964,457 V477G possibly damaging Het
Exosc8 T C 3: 54,729,290 I207V possibly damaging Het
Fam173a T G 17: 25,791,678 probably null Het
Fat4 T A 3: 39,007,203 S4312T probably benign Het
Fgfr2 T C 7: 130,241,277 D126G probably damaging Het
Fgfr4 A G 13: 55,168,170 T799A unknown Het
Gcn1l1 A T 5: 115,592,144 D839V probably benign Het
Gprin3 A G 6: 59,354,173 V383A probably benign Het
Gpt T C 15: 76,698,840 V361A probably benign Het
Hepacam G A 9: 37,381,764 C217Y probably damaging Het
Hsp90aa1 A T 12: 110,693,717 Y382N probably damaging Het
Htr2a T A 14: 74,642,022 N30K probably benign Het
Jhy A T 9: 40,961,003 M70K possibly damaging Het
Lrrc19 T C 4: 94,640,937 Y36C probably damaging Het
Madcam1 C T 10: 79,665,613 Q171* probably null Het
Mcm8 G A 2: 132,838,709 M544I probably benign Het
Mdga1 C T 17: 29,857,606 G338E probably damaging Het
Mettl7a1 T A 15: 100,305,106 F87Y probably benign Het
Mmp3 A G 9: 7,446,994 D58G probably benign Het
Ms4a10 T C 19: 10,964,768 Y123C probably damaging Het
Ms4a4d T A 19: 11,557,932 I198K probably benign Het
Mthfd1l A T 10: 3,980,241 D112V probably benign Het
N4bp2l2 A C 5: 150,643,141 S567R probably benign Het
Ndufaf2 A G 13: 108,158,476 Y32H probably damaging Het
Nup153 T A 13: 46,712,737 K251* probably null Het
Olfr1186 A G 2: 88,525,735 T51A probably benign Het
Olfr481 T A 7: 108,081,574 V260E probably damaging Het
Olfr551 A G 7: 102,588,416 F109S probably damaging Het
Otoa T C 7: 121,155,135 S928P probably damaging Het
Oxct2a T C 4: 123,322,703 D295G probably benign Het
P4ha2 C A 11: 54,125,020 T411K probably benign Het
Plcg2 A T 8: 117,607,083 Q865L probably benign Het
Prepl G T 17: 85,078,504 T244K possibly damaging Het
Ptpro A T 6: 137,411,105 K776* probably null Het
Rc3h2 T C 2: 37,389,832 K462E possibly damaging Het
Scn10a A G 9: 119,687,874 probably null Het
Serpinb1c A G 13: 32,882,164 V266A probably damaging Het
Slc6a20b T A 9: 123,604,796 N326Y probably damaging Het
Spcs2 C T 7: 99,858,831 G16D possibly damaging Het
Spns3 T C 11: 72,499,495 D441G possibly damaging Het
Srsf4 A G 4: 131,891,245 D49G probably damaging Het
Tec A T 5: 72,760,393 C494* probably null Het
Tecpr1 A T 5: 144,204,658 Y798N probably damaging Het
Trim56 C T 5: 137,114,489 E58K probably damaging Het
Ttn A T 2: 76,796,134 D13146E probably damaging Het
Ube2q1 A T 3: 89,779,483 K215* probably null Het
Ucn G T 5: 31,138,498 T8K probably benign Het
Usp25 T C 16: 77,033,982 probably null Het
Usp48 A T 4: 137,615,833 Q430L probably benign Het
Usp48 A T 4: 137,615,834 Q430H probably null Het
Vmn2r91 T A 17: 18,136,489 M806K possibly damaging Het
Wdfy4 T A 14: 33,029,013 Y2256F probably damaging Het
Wsb1 A G 11: 79,251,000 S64P probably damaging Het
Zc3h11a C A 1: 133,624,612 V586F probably benign Het
Zc3h12d A G 10: 7,853,250 D126G probably damaging Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp442 T A 2: 150,409,715 H89L possibly damaging Het
Zfp82 T A 7: 30,056,887 K287* probably null Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Other mutations in Vill
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Vill APN 9 119063312 missense probably damaging 1.00
IGL01024:Vill APN 9 119070350 critical splice donor site probably null
IGL01934:Vill APN 9 119066809 missense probably damaging 1.00
IGL02118:Vill APN 9 119060398 missense probably benign 0.44
IGL02260:Vill APN 9 119058441 missense probably benign 0.00
IGL02507:Vill APN 9 119070777 missense possibly damaging 0.86
IGL02870:Vill APN 9 119061899 missense probably damaging 1.00
IGL02941:Vill APN 9 119066887 unclassified probably benign
IGL02835:Vill UTSW 9 119067445 missense probably benign 0.11
R0285:Vill UTSW 9 119070827 splice site probably benign
R0571:Vill UTSW 9 119070633 missense possibly damaging 0.93
R1024:Vill UTSW 9 119066824 missense probably damaging 1.00
R1168:Vill UTSW 9 119070321 missense probably damaging 0.99
R1374:Vill UTSW 9 119061494 missense probably benign 0.03
R1400:Vill UTSW 9 119063347 missense probably benign 0.01
R1551:Vill UTSW 9 119063372 missense probably benign
R1584:Vill UTSW 9 119065586 missense probably damaging 1.00
R1630:Vill UTSW 9 119070701 missense probably benign 0.37
R1721:Vill UTSW 9 119066014 missense probably damaging 0.98
R1946:Vill UTSW 9 119058492 missense probably benign
R2311:Vill UTSW 9 119065897 missense probably benign 0.08
R2392:Vill UTSW 9 119067560 splice site probably benign
R2509:Vill UTSW 9 119070302 missense possibly damaging 0.84
R2760:Vill UTSW 9 119066882 critical splice donor site probably null
R3886:Vill UTSW 9 119066714 missense probably benign 0.24
R3944:Vill UTSW 9 119068431 missense probably benign 0.10
R4245:Vill UTSW 9 119071291 utr 3 prime probably benign
R4246:Vill UTSW 9 119060393 missense probably damaging 1.00
R4771:Vill UTSW 9 119068434 missense probably damaging 1.00
R4889:Vill UTSW 9 119063341 missense possibly damaging 0.50
R4946:Vill UTSW 9 119068440 missense probably damaging 1.00
R5121:Vill UTSW 9 119070025 missense possibly damaging 0.92
R5646:Vill UTSW 9 119071162 missense probably damaging 1.00
R6089:Vill UTSW 9 119057799 missense probably benign 0.00
R6149:Vill UTSW 9 119058414 missense possibly damaging 0.67
R6167:Vill UTSW 9 119066864 missense probably damaging 0.98
R6318:Vill UTSW 9 119063648 missense probably benign 0.15
R6319:Vill UTSW 9 119063648 missense probably benign 0.15
R6593:Vill UTSW 9 119061907 missense probably benign 0.04
R6690:Vill UTSW 9 119061907 missense probably benign 0.04
R6889:Vill UTSW 9 119065882 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AATGACATGCCCTGCCTTG -3'
(R):5'- CCTGTATCTAGTAGACGCCCTTTG -3'

Sequencing Primer
(F):5'- ACATGCCCTGCCTTGCTCTC -3'
(R):5'- GCCCTTTGGGTGGAAACAG -3'
Posted On2016-04-15