Incidental Mutation 'R4932:Gpt'
ID380677
Institutional Source Beutler Lab
Gene Symbol Gpt
Ensembl Gene ENSMUSG00000022546
Gene Nameglutamic pyruvic transaminase, soluble
Synonyms1300007J06Rik, Gpt1, Gpt-1, 2310022B03Rik, ALT
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R4932 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76695716-76699686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76698840 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 361 (V361A)
Ref Sequence ENSEMBL: ENSMUSP00000155553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000023203] [ENSMUST00000036852] [ENSMUST00000037551] [ENSMUST00000135388] [ENSMUST00000150399] [ENSMUST00000229140] [ENSMUST00000229679] [ENSMUST00000229734] [ENSMUST00000230544] [ENSMUST00000230724] [ENSMUST00000231028]
Predicted Effect probably benign
Transcript: ENSMUST00000019224
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023203
AA Change: V361A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546
AA Change: V361A

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036852
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000037551
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134449
Predicted Effect probably benign
Transcript: ENSMUST00000135388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140730
Predicted Effect probably benign
Transcript: ENSMUST00000150399
SMART Domains Protein: ENSMUSP00000123458
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229098
Predicted Effect probably benign
Transcript: ENSMUST00000229140
AA Change: V121A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229340
Predicted Effect probably benign
Transcript: ENSMUST00000229679
AA Change: V361A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000229734
AA Change: V340A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230482
Predicted Effect probably benign
Transcript: ENSMUST00000230544
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Predicted Effect probably benign
Transcript: ENSMUST00000231028
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes cytosolic alanine aminotransaminase 1 (ALT1); also known as glutamate-pyruvate transaminase 1. This enzyme catalyzes the reversible transamination between alanine and 2-oxoglutarate to generate pyruvate and glutamate and, therefore, plays a key role in the intermediary metabolism of glucose and amino acids. Serum activity levels of this enzyme are routinely used as a biomarker of liver injury caused by drug toxicity, infection, alcohol, and steatosis. A related gene on chromosome 16 encodes a putative mitochondrial alanine aminotransaminase.[provided by RefSeq, Nov 2009]
PHENOTYPE: Electrophoretic variants are detected in C57BL/6, BALB/c and DBA/2 (a allele); in MA/J and NZB/Bl (b allele). M. m. molossinus and M. m. castaneus have either the b or c allele. In liver, GPT1 activity rises dramatically at 12-19 days to adult levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,932,630 T121S possibly damaging Het
Abcf1 A T 17: 35,959,450 V616E possibly damaging Het
Adam21 A G 12: 81,558,918 V690A probably benign Het
Afg3l1 A T 8: 123,501,380 T635S probably damaging Het
Ahcyl2 T A 6: 29,890,701 M390K probably benign Het
Ank3 T A 10: 69,898,223 probably null Het
Arhgef3 A T 14: 27,384,213 K151N probably damaging Het
Ccr3 T G 9: 124,029,006 F126C probably damaging Het
Ccser1 A G 6: 61,718,191 D170G possibly damaging Het
Celsr2 T A 3: 108,402,758 D1552V probably damaging Het
Cfap69 G A 5: 5,625,820 L265F probably damaging Het
Chrna9 C T 5: 65,969,190 R92* probably null Het
Cog3 A T 14: 75,732,954 V341D probably damaging Het
Csmd1 C A 8: 16,023,765 R2072L probably damaging Het
Dbf4 G T 5: 8,398,039 H390Q probably benign Het
Dcaf4 T A 12: 83,532,304 C166S possibly damaging Het
Dclk3 T A 9: 111,468,042 L218Q possibly damaging Het
Dip2b T A 15: 100,171,722 W643R probably damaging Het
Dip2c A G 13: 9,623,972 K1091E probably damaging Het
Dis3 T A 14: 99,088,904 H415L probably damaging Het
Dnah7a T A 1: 53,503,578 I2478F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Doc2a T C 7: 126,848,580 probably benign Het
Dph5 A T 3: 115,899,807 M125L probably benign Het
Dst A T 1: 34,228,683 T5247S possibly damaging Het
Eno4 T G 19: 58,964,457 V477G possibly damaging Het
Exosc8 T C 3: 54,729,290 I207V possibly damaging Het
Fam173a T G 17: 25,791,678 probably null Het
Fat4 T A 3: 39,007,203 S4312T probably benign Het
Fgfr2 T C 7: 130,241,277 D126G probably damaging Het
Fgfr4 A G 13: 55,168,170 T799A unknown Het
Gcn1l1 A T 5: 115,592,144 D839V probably benign Het
Gprin3 A G 6: 59,354,173 V383A probably benign Het
Hepacam G A 9: 37,381,764 C217Y probably damaging Het
Hsp90aa1 A T 12: 110,693,717 Y382N probably damaging Het
Htr2a T A 14: 74,642,022 N30K probably benign Het
Jhy A T 9: 40,961,003 M70K possibly damaging Het
Lrrc19 T C 4: 94,640,937 Y36C probably damaging Het
Madcam1 C T 10: 79,665,613 Q171* probably null Het
Mcm8 G A 2: 132,838,709 M544I probably benign Het
Mdga1 C T 17: 29,857,606 G64E probably damaging Het
Mettl7a1 T A 15: 100,305,106 F87Y probably benign Het
Mmp3 A G 9: 7,446,994 D58G probably benign Het
Ms4a10 T C 19: 10,964,768 Y123C probably damaging Het
Ms4a4d T A 19: 11,557,932 I198K probably benign Het
Mthfd1l A T 10: 3,980,241 D112V probably benign Het
N4bp2l2 A C 5: 150,643,141 S567R probably benign Het
Ndufaf2 A G 13: 108,158,476 Y32H probably damaging Het
Nup153 T A 13: 46,712,737 K182* probably null Het
Olfr1186 A G 2: 88,525,735 T51A probably benign Het
Olfr481 T A 7: 108,081,574 V260E probably damaging Het
Olfr551 A G 7: 102,588,416 F109S probably damaging Het
Otoa T C 7: 121,155,135 S928P probably damaging Het
Oxct2a T C 4: 123,322,703 D295G probably benign Het
P4ha2 C A 11: 54,125,020 T411K probably benign Het
Plcg2 A T 8: 117,607,083 Q865L probably benign Het
Prepl G T 17: 85,078,504 T244K possibly damaging Het
Ptpro A T 6: 137,411,105 K776* probably null Het
Rc3h2 T C 2: 37,389,832 K462E possibly damaging Het
Scn10a A G 9: 119,687,874 probably null Het
Serpinb1c A G 13: 32,882,164 V266A probably damaging Het
Slc6a20b T A 9: 123,604,796 N326Y probably damaging Het
Spcs2 C T 7: 99,858,831 G16D possibly damaging Het
Spns3 T C 11: 72,499,495 D441G possibly damaging Het
Srsf4 A G 4: 131,891,245 D49G probably damaging Het
Tec A T 5: 72,760,393 C494* probably null Het
Tecpr1 A T 5: 144,204,658 Y798N probably damaging Het
Trim56 C T 5: 137,114,489 E58K probably damaging Het
Ttn A T 2: 76,796,134 D13146E probably damaging Het
Ube2q1 A T 3: 89,779,483 K46* probably null Het
Ucn G T 5: 31,138,498 T8K probably benign Het
Usp25 T C 16: 77,033,982 probably null Het
Usp48 A T 4: 137,615,833 Q430L probably benign Het
Usp48 A T 4: 137,615,834 probably null Het
Vill A T 9: 119,061,511 D164V probably damaging Het
Vmn2r91 T A 17: 18,136,489 M806K possibly damaging Het
Wdfy4 T A 14: 33,029,013 Y2256F probably damaging Het
Wsb1 A G 11: 79,251,000 S64P probably damaging Het
Zc3h11a C A 1: 133,624,612 V586F probably benign Het
Zc3h12d A G 10: 7,853,250 D126G probably damaging Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp442 T A 2: 150,409,715 H89L possibly damaging Het
Zfp82 T A 7: 30,056,887 probably null Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Other mutations in Gpt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Gpt APN 15 76698782 missense probably damaging 1.00
IGL02061:Gpt APN 15 76699417 unclassified probably benign
IGL03027:Gpt APN 15 76698089 unclassified probably benign
R2091:Gpt UTSW 15 76697976 missense possibly damaging 0.87
R2903:Gpt UTSW 15 76698466 missense probably damaging 1.00
R3835:Gpt UTSW 15 76698583 missense probably damaging 1.00
R4496:Gpt UTSW 15 76698463 missense probably damaging 1.00
R4855:Gpt UTSW 15 76699285 missense probably damaging 0.99
R5970:Gpt UTSW 15 76699352 splice site probably null
R6165:Gpt UTSW 15 76697970 missense probably benign 0.28
R6914:Gpt UTSW 15 76697592 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTCTAAGGGCTACATGGG -3'
(R):5'- TTAGCCTTGGCTGCCAGTTC -3'

Sequencing Primer
(F):5'- AGGGCTAGAGGACTCTCAGTC -3'
(R):5'- AGTTCAGCCAGCACCTCCTG -3'
Posted On2016-04-15