Incidental Mutation 'R4932:Abcf1'
ID380686
Institutional Source Beutler Lab
Gene Symbol Abcf1
Ensembl Gene ENSMUSG00000038762
Gene NameATP-binding cassette, sub-family F (GCN20), member 1
SynonymsGCN20, D17Wsu166e, Abc50
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R4932 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35956819-35969761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35959450 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 616 (V616E)
Ref Sequence ENSEMBL: ENSMUSP00000036881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043757] [ENSMUST00000172661] [ENSMUST00000174128]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043757
AA Change: V616E

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036881
Gene: ENSMUSG00000038762
AA Change: V616E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 25 40 N/A INTRINSIC
coiled coil region 46 79 N/A INTRINSIC
low complexity region 173 208 N/A INTRINSIC
low complexity region 218 234 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
AAA 320 524 9e-10 SMART
low complexity region 529 554 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
AAA 642 807 1.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104738
Predicted Effect probably benign
Transcript: ENSMUST00000172661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173125
Predicted Effect probably benign
Transcript: ENSMUST00000174128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174834
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the GCN20 subfamily. Unlike other members of the superfamily, this protein lacks the transmembrane domains which are characteristic of most ABC transporters. This protein may be regulated by tumor necrosis factor-alpha and play a role in enhancement of protein synthesis and the inflammation process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,932,630 T121S possibly damaging Het
Adam21 A G 12: 81,558,918 V690A probably benign Het
Afg3l1 A T 8: 123,501,380 T635S probably damaging Het
Ahcyl2 T A 6: 29,890,701 M390K probably benign Het
Ank3 T A 10: 69,898,223 probably null Het
Arhgef3 A T 14: 27,384,213 K151N probably damaging Het
Ccr3 T G 9: 124,029,006 F126C probably damaging Het
Ccser1 A G 6: 61,718,191 D170G possibly damaging Het
Celsr2 T A 3: 108,402,758 D1552V probably damaging Het
Cfap69 G A 5: 5,625,820 L265F probably damaging Het
Chrna9 C T 5: 65,969,190 R92* probably null Het
Cog3 A T 14: 75,732,954 V341D probably damaging Het
Csmd1 C A 8: 16,023,765 R2072L probably damaging Het
Dbf4 G T 5: 8,398,039 H390Q probably benign Het
Dcaf4 T A 12: 83,532,304 C166S possibly damaging Het
Dclk3 T A 9: 111,468,042 L218Q possibly damaging Het
Dip2b T A 15: 100,171,722 W643R probably damaging Het
Dip2c A G 13: 9,623,972 K1091E probably damaging Het
Dis3 T A 14: 99,088,904 H415L probably damaging Het
Dnah7a T A 1: 53,503,578 I2478F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Doc2a T C 7: 126,848,580 probably benign Het
Dph5 A T 3: 115,899,807 M125L probably benign Het
Dst A T 1: 34,228,683 T5247S possibly damaging Het
Eno4 T G 19: 58,964,457 V477G possibly damaging Het
Exosc8 T C 3: 54,729,290 I207V possibly damaging Het
Fam173a T G 17: 25,791,678 probably null Het
Fat4 T A 3: 39,007,203 S4312T probably benign Het
Fgfr2 T C 7: 130,241,277 D126G probably damaging Het
Fgfr4 A G 13: 55,168,170 T799A unknown Het
Gcn1l1 A T 5: 115,592,144 D839V probably benign Het
Gprin3 A G 6: 59,354,173 V383A probably benign Het
Gpt T C 15: 76,698,840 V361A probably benign Het
Hepacam G A 9: 37,381,764 C217Y probably damaging Het
Hsp90aa1 A T 12: 110,693,717 Y382N probably damaging Het
Htr2a T A 14: 74,642,022 N30K probably benign Het
Jhy A T 9: 40,961,003 M70K possibly damaging Het
Lrrc19 T C 4: 94,640,937 Y36C probably damaging Het
Madcam1 C T 10: 79,665,613 Q171* probably null Het
Mcm8 G A 2: 132,838,709 M544I probably benign Het
Mdga1 C T 17: 29,857,606 G64E probably damaging Het
Mettl7a1 T A 15: 100,305,106 F87Y probably benign Het
Mmp3 A G 9: 7,446,994 D58G probably benign Het
Ms4a10 T C 19: 10,964,768 Y123C probably damaging Het
Ms4a4d T A 19: 11,557,932 I198K probably benign Het
Mthfd1l A T 10: 3,980,241 D112V probably benign Het
N4bp2l2 A C 5: 150,643,141 S567R probably benign Het
Ndufaf2 A G 13: 108,158,476 Y32H probably damaging Het
Nup153 T A 13: 46,712,737 K182* probably null Het
Olfr1186 A G 2: 88,525,735 T51A probably benign Het
Olfr481 T A 7: 108,081,574 V260E probably damaging Het
Olfr551 A G 7: 102,588,416 F109S probably damaging Het
Otoa T C 7: 121,155,135 S928P probably damaging Het
Oxct2a T C 4: 123,322,703 D295G probably benign Het
P4ha2 C A 11: 54,125,020 T411K probably benign Het
Plcg2 A T 8: 117,607,083 Q865L probably benign Het
Prepl G T 17: 85,078,504 T244K possibly damaging Het
Ptpro A T 6: 137,411,105 K776* probably null Het
Rc3h2 T C 2: 37,389,832 K462E possibly damaging Het
Scn10a A G 9: 119,687,874 probably null Het
Serpinb1c A G 13: 32,882,164 V266A probably damaging Het
Slc6a20b T A 9: 123,604,796 N326Y probably damaging Het
Spcs2 C T 7: 99,858,831 G16D possibly damaging Het
Spns3 T C 11: 72,499,495 D441G possibly damaging Het
Srsf4 A G 4: 131,891,245 D49G probably damaging Het
Tec A T 5: 72,760,393 C494* probably null Het
Tecpr1 A T 5: 144,204,658 Y798N probably damaging Het
Trim56 C T 5: 137,114,489 E58K probably damaging Het
Ttn A T 2: 76,796,134 D13146E probably damaging Het
Ube2q1 A T 3: 89,779,483 K46* probably null Het
Ucn G T 5: 31,138,498 T8K probably benign Het
Usp25 T C 16: 77,033,982 probably null Het
Usp48 A T 4: 137,615,833 Q430L probably benign Het
Usp48 A T 4: 137,615,834 probably null Het
Vill A T 9: 119,061,511 D164V probably damaging Het
Vmn2r91 T A 17: 18,136,489 M806K possibly damaging Het
Wdfy4 T A 14: 33,029,013 Y2256F probably damaging Het
Wsb1 A G 11: 79,251,000 S64P probably damaging Het
Zc3h11a C A 1: 133,624,612 V586F probably benign Het
Zc3h12d A G 10: 7,853,250 D126G probably damaging Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp442 T A 2: 150,409,715 H89L possibly damaging Het
Zfp82 T A 7: 30,056,887 probably null Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Other mutations in Abcf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Abcf1 APN 17 35964010 missense probably damaging 1.00
IGL02008:Abcf1 APN 17 35962062 missense probably benign
IGL02209:Abcf1 APN 17 35964009 missense probably damaging 0.99
IGL02218:Abcf1 APN 17 35958338 missense probably benign 0.00
IGL02455:Abcf1 APN 17 35960129 missense probably damaging 1.00
IGL03238:Abcf1 APN 17 35963323 missense probably damaging 0.99
bamboo UTSW 17 35958062 splice site probably benign
IGL02837:Abcf1 UTSW 17 35957581 missense probably benign
R0007:Abcf1 UTSW 17 35959670 missense probably damaging 0.99
R0078:Abcf1 UTSW 17 35958062 splice site probably benign
R0617:Abcf1 UTSW 17 35961187 missense probably benign 0.00
R0655:Abcf1 UTSW 17 35957845 missense probably benign 0.20
R1421:Abcf1 UTSW 17 35960909 missense probably damaging 1.00
R1879:Abcf1 UTSW 17 35961812 missense probably benign 0.13
R3433:Abcf1 UTSW 17 35958217 missense probably benign 0.36
R3915:Abcf1 UTSW 17 35959510 missense possibly damaging 0.46
R4056:Abcf1 UTSW 17 35959915 missense possibly damaging 0.90
R4057:Abcf1 UTSW 17 35959915 missense possibly damaging 0.90
R4114:Abcf1 UTSW 17 35959254 missense probably benign 0.25
R4709:Abcf1 UTSW 17 35960177 missense probably damaging 1.00
R4722:Abcf1 UTSW 17 35958041 intron probably benign
R5129:Abcf1 UTSW 17 35960795 unclassified probably benign
R5255:Abcf1 UTSW 17 35959737 intron probably null
R5517:Abcf1 UTSW 17 35958341 missense possibly damaging 0.48
R5518:Abcf1 UTSW 17 35958341 missense possibly damaging 0.48
R5660:Abcf1 UTSW 17 35963647 missense possibly damaging 0.87
R5836:Abcf1 UTSW 17 35962026 missense possibly damaging 0.77
R6193:Abcf1 UTSW 17 35963572 missense possibly damaging 0.77
R6247:Abcf1 UTSW 17 35961064 missense probably damaging 1.00
R6257:Abcf1 UTSW 17 35961182 missense probably benign 0.10
R6876:Abcf1 UTSW 17 35959244 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ACTTACTCCGGGAGTCCATG -3'
(R):5'- CCCCAGTGACCTTCAAGAAG -3'

Sequencing Primer
(F):5'- CTAGATTCTTAAAGAGTGGCTTCTGC -3'
(R):5'- GTGACCTTCAAGAAGATGTACCAGC -3'
Posted On2016-04-15