Incidental Mutation 'R4932:Ms4a10'
ID380688
Institutional Source Beutler Lab
Gene Symbol Ms4a10
Ensembl Gene ENSMUSG00000024731
Gene Namemembrane-spanning 4-domains, subfamily A, member 10
Synonyms2010001N17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.034) question?
Stock #R4932 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10962293-10974670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10964768 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 123 (Y123C)
Ref Sequence ENSEMBL: ENSMUSP00000140111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072748] [ENSMUST00000190246] [ENSMUST00000191343]
Predicted Effect probably damaging
Transcript: ENSMUST00000072748
AA Change: Y163C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072531
Gene: ENSMUSG00000024731
AA Change: Y163C

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:CD20 56 190 6e-10 PFAM
low complexity region 239 252 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190246
AA Change: Y35C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140826
Gene: ENSMUSG00000024731
AA Change: Y35C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191343
AA Change: Y123C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140111
Gene: ENSMUSG00000024731
AA Change: Y123C

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:CD20 57 150 7.9e-14 PFAM
low complexity region 199 212 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Most MS4A genes, including MS4A10, encode proteins with at least 4 potential transmembrane domains and N- and C-terminal cytoplasmic domains encoded by distinct exons.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,932,630 T121S possibly damaging Het
Abcf1 A T 17: 35,959,450 V616E possibly damaging Het
Adam21 A G 12: 81,558,918 V690A probably benign Het
Afg3l1 A T 8: 123,501,380 T635S probably damaging Het
Ahcyl2 T A 6: 29,890,701 M390K probably benign Het
Ank3 T A 10: 69,898,223 probably null Het
Arhgef3 A T 14: 27,384,213 K151N probably damaging Het
Ccr3 T G 9: 124,029,006 F126C probably damaging Het
Ccser1 A G 6: 61,718,191 D170G possibly damaging Het
Celsr2 T A 3: 108,402,758 D1552V probably damaging Het
Cfap69 G A 5: 5,625,820 L265F probably damaging Het
Chrna9 C T 5: 65,969,190 R92* probably null Het
Cog3 A T 14: 75,732,954 V341D probably damaging Het
Csmd1 C A 8: 16,023,765 R2072L probably damaging Het
Dbf4 G T 5: 8,398,039 H390Q probably benign Het
Dcaf4 T A 12: 83,532,304 C166S possibly damaging Het
Dclk3 T A 9: 111,468,042 L218Q possibly damaging Het
Dip2b T A 15: 100,171,722 W643R probably damaging Het
Dip2c A G 13: 9,623,972 K1091E probably damaging Het
Dis3 T A 14: 99,088,904 H415L probably damaging Het
Dnah7a T A 1: 53,503,578 I2478F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Doc2a T C 7: 126,848,580 probably benign Het
Dph5 A T 3: 115,899,807 M125L probably benign Het
Dst A T 1: 34,228,683 T5247S possibly damaging Het
Eno4 T G 19: 58,964,457 V477G possibly damaging Het
Exosc8 T C 3: 54,729,290 I207V possibly damaging Het
Fam173a T G 17: 25,791,678 probably null Het
Fat4 T A 3: 39,007,203 S4312T probably benign Het
Fgfr2 T C 7: 130,241,277 D126G probably damaging Het
Fgfr4 A G 13: 55,168,170 T799A unknown Het
Gcn1l1 A T 5: 115,592,144 D839V probably benign Het
Gprin3 A G 6: 59,354,173 V383A probably benign Het
Gpt T C 15: 76,698,840 V361A probably benign Het
Hepacam G A 9: 37,381,764 C217Y probably damaging Het
Hsp90aa1 A T 12: 110,693,717 Y382N probably damaging Het
Htr2a T A 14: 74,642,022 N30K probably benign Het
Jhy A T 9: 40,961,003 M70K possibly damaging Het
Lrrc19 T C 4: 94,640,937 Y36C probably damaging Het
Madcam1 C T 10: 79,665,613 Q171* probably null Het
Mcm8 G A 2: 132,838,709 M544I probably benign Het
Mdga1 C T 17: 29,857,606 G64E probably damaging Het
Mettl7a1 T A 15: 100,305,106 F87Y probably benign Het
Mmp3 A G 9: 7,446,994 D58G probably benign Het
Ms4a4d T A 19: 11,557,932 I198K probably benign Het
Mthfd1l A T 10: 3,980,241 D112V probably benign Het
N4bp2l2 A C 5: 150,643,141 S567R probably benign Het
Ndufaf2 A G 13: 108,158,476 Y32H probably damaging Het
Nup153 T A 13: 46,712,737 K182* probably null Het
Olfr1186 A G 2: 88,525,735 T51A probably benign Het
Olfr481 T A 7: 108,081,574 V260E probably damaging Het
Olfr551 A G 7: 102,588,416 F109S probably damaging Het
Otoa T C 7: 121,155,135 S928P probably damaging Het
Oxct2a T C 4: 123,322,703 D295G probably benign Het
P4ha2 C A 11: 54,125,020 T411K probably benign Het
Plcg2 A T 8: 117,607,083 Q865L probably benign Het
Prepl G T 17: 85,078,504 T244K possibly damaging Het
Ptpro A T 6: 137,411,105 K776* probably null Het
Rc3h2 T C 2: 37,389,832 K462E possibly damaging Het
Scn10a A G 9: 119,687,874 probably null Het
Serpinb1c A G 13: 32,882,164 V266A probably damaging Het
Slc6a20b T A 9: 123,604,796 N326Y probably damaging Het
Spcs2 C T 7: 99,858,831 G16D possibly damaging Het
Spns3 T C 11: 72,499,495 D441G possibly damaging Het
Srsf4 A G 4: 131,891,245 D49G probably damaging Het
Tec A T 5: 72,760,393 C494* probably null Het
Tecpr1 A T 5: 144,204,658 Y798N probably damaging Het
Trim56 C T 5: 137,114,489 E58K probably damaging Het
Ttn A T 2: 76,796,134 D13146E probably damaging Het
Ube2q1 A T 3: 89,779,483 K46* probably null Het
Ucn G T 5: 31,138,498 T8K probably benign Het
Usp25 T C 16: 77,033,982 probably null Het
Usp48 A T 4: 137,615,833 Q430L probably benign Het
Usp48 A T 4: 137,615,834 probably null Het
Vill A T 9: 119,061,511 D164V probably damaging Het
Vmn2r91 T A 17: 18,136,489 M806K possibly damaging Het
Wdfy4 T A 14: 33,029,013 Y2256F probably damaging Het
Wsb1 A G 11: 79,251,000 S64P probably damaging Het
Zc3h11a C A 1: 133,624,612 V586F probably benign Het
Zc3h12d A G 10: 7,853,250 D126G probably damaging Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp442 T A 2: 150,409,715 H89L possibly damaging Het
Zfp82 T A 7: 30,056,887 probably null Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Other mutations in Ms4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Ms4a10 APN 19 10963010 missense probably benign
IGL03031:Ms4a10 APN 19 10968671 missense probably benign 0.01
P0027:Ms4a10 UTSW 19 10964128 missense probably damaging 0.99
R0863:Ms4a10 UTSW 19 10968593 missense probably damaging 1.00
R1456:Ms4a10 UTSW 19 10964733 missense possibly damaging 0.91
R1509:Ms4a10 UTSW 19 10964108 missense probably benign 0.01
R1838:Ms4a10 UTSW 19 10964047 missense possibly damaging 0.92
R4583:Ms4a10 UTSW 19 10968189 missense possibly damaging 0.94
R5548:Ms4a10 UTSW 19 10968120 critical splice donor site probably null
R5819:Ms4a10 UTSW 19 10968690 missense probably benign 0.00
R5952:Ms4a10 UTSW 19 10964122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTCTGTCCATTCTGAG -3'
(R):5'- AGAGCTGTCCATGACCCTTAG -3'

Sequencing Primer
(F):5'- GCTCTCTGCTGTCTAATGTGTC -3'
(R):5'- CCAGGGGCTTGAGAGACTC -3'
Posted On2016-04-15