Incidental Mutation 'R4933:Sptbn5'
ID380698
Institutional Source Beutler Lab
Gene Symbol Sptbn5
Ensembl Gene ENSMUSG00000074899
Gene Namespectrin beta, non-erythrocytic 5
SynonymsEG640524, Spnb5
MMRRC Submission 042533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R4933 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120046157-120085772 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to A at 120050120 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156159
SMART Domains Protein: ENSMUSP00000115974
Gene: ENSMUSG00000074899

DomainStartEndE-ValueType
SPEC 60 160 2.54e-6 SMART
SPEC 166 266 1.32e-13 SMART
SPEC 272 372 4.41e-15 SMART
SPEC 378 477 1.56e-15 SMART
SPEC 483 583 1.11e-11 SMART
SPEC 589 689 8.47e-26 SMART
SPEC 695 795 5.56e-12 SMART
SPEC 801 902 7.01e-9 SMART
SPEC 908 1032 4.44e-1 SMART
SPEC 1038 1138 3.73e-13 SMART
Pfam:Spectrin 1141 1206 2.2e-6 PFAM
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Sptbn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Sptbn5 APN 2 120054467 unclassified probably benign
IGL01552:Sptbn5 APN 2 120054422 unclassified probably benign
IGL01800:Sptbn5 APN 2 120056427 unclassified probably benign
IGL02156:Sptbn5 APN 2 120047617 unclassified probably benign
R0020:Sptbn5 UTSW 2 120065631 missense probably damaging 0.96
R0690:Sptbn5 UTSW 2 120062675 unclassified probably null
R1121:Sptbn5 UTSW 2 120069390 unclassified probably null
R1223:Sptbn5 UTSW 2 120072044 missense probably damaging 0.99
R1405:Sptbn5 UTSW 2 120050616 splice site noncoding transcript
R1852:Sptbn5 UTSW 2 120071644 missense possibly damaging 0.52
R1927:Sptbn5 UTSW 2 120070462 missense probably benign 0.00
R2570:Sptbn5 UTSW 2 120048640 exon noncoding transcript
R3898:Sptbn5 UTSW 2 120057210 exon noncoding transcript
R3976:Sptbn5 UTSW 2 120048261 splice site noncoding transcript
R4092:Sptbn5 UTSW 2 120067051 missense probably damaging 0.99
R4119:Sptbn5 UTSW 2 120064529 missense possibly damaging 0.91
R4120:Sptbn5 UTSW 2 120064529 missense possibly damaging 0.91
R4351:Sptbn5 UTSW 2 120083199 exon noncoding transcript
R4352:Sptbn5 UTSW 2 120083199 exon noncoding transcript
R4364:Sptbn5 UTSW 2 120068655 missense probably damaging 1.00
R4371:Sptbn5 UTSW 2 120065994 missense probably damaging 1.00
R4606:Sptbn5 UTSW 2 120067446 unclassified probably null
R4616:Sptbn5 UTSW 2 120048757 exon noncoding transcript
R4687:Sptbn5 UTSW 2 120077208 unclassified probably benign
R4693:Sptbn5 UTSW 2 120059416 unclassified probably benign
R4762:Sptbn5 UTSW 2 120077222 unclassified noncoding transcript
R4798:Sptbn5 UTSW 2 120059141 unclassified probably benign
R4818:Sptbn5 UTSW 2 120067968 missense probably benign 0.05
R4822:Sptbn5 UTSW 2 120067968 missense probably benign 0.05
R4825:Sptbn5 UTSW 2 120055893 unclassified probably benign
R4970:Sptbn5 UTSW 2 120051777 exon noncoding transcript
R5141:Sptbn5 UTSW 2 120061731 missense probably benign 0.03
R5209:Sptbn5 UTSW 2 120072002 missense probably benign 0.09
R5225:Sptbn5 UTSW 2 120085331 unclassified probably benign
R5227:Sptbn5 UTSW 2 120085331 unclassified probably benign
R5421:Sptbn5 UTSW 2 120080780 critical splice donor site noncoding transcript
R5495:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5498:Sptbn5 UTSW 2 120076638 unclassified probably benign
R5511:Sptbn5 UTSW 2 120059721 unclassified probably benign
R5596:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5616:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5617:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5619:Sptbn5 UTSW 2 120050132 exon noncoding transcript
R5625:Sptbn5 UTSW 2 120079792 exon noncoding transcript
R5636:Sptbn5 UTSW 2 120057404 unclassified probably benign
R5646:Sptbn5 UTSW 2 120048811 splice site noncoding transcript
R5666:Sptbn5 UTSW 2 120085567 unclassified probably benign
R5670:Sptbn5 UTSW 2 120085567 unclassified probably benign
R5715:Sptbn5 UTSW 2 120072504 missense probably damaging 1.00
R5774:Sptbn5 UTSW 2 120050458 exon noncoding transcript
R5885:Sptbn5 UTSW 2 120076663 unclassified probably benign
R6016:Sptbn5 UTSW 2 120050092 exon noncoding transcript
R6183:Sptbn5 UTSW 2 120059417 unclassified probably benign
R6184:Sptbn5 UTSW 2 120059417 unclassified probably benign
R6219:Sptbn5 UTSW 2 120077322 unclassified probably benign
R6335:Sptbn5 UTSW 2 120054419 unclassified probably benign
R6383:Sptbn5 UTSW 2 120046269 unclassified probably benign
R6450:Sptbn5 UTSW 2 120047135 unclassified probably benign
R6516:Sptbn5 UTSW 2 120047950 unclassified probably benign
R6523:Sptbn5 UTSW 2 120065614 unclassified probably null
R6657:Sptbn5 UTSW 2 120076400 unclassified probably benign
R6661:Sptbn5 UTSW 2 120072375 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GCCCTGATGATTCATTGGACC -3'
(R):5'- ACTAGTTTCAACACTGGCCC -3'

Sequencing Primer
(F):5'- CTGATGATTCATTGGACCCTACAGAC -3'
(R):5'- AACACTGGCCCACTCTGGTTG -3'
Posted On2016-04-15