Incidental Mutation 'R4933:Pot1a'
ID380712
Institutional Source Beutler Lab
Gene Symbol Pot1a
Ensembl Gene ENSMUSG00000029676
Gene Nameprotection of telomeres 1A
Synonyms1500031H18Rik, Pot1
MMRRC Submission 042533-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4933 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location25743737-25809246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25771541 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 227 (V227A)
Ref Sequence ENSEMBL: ENSMUSP00000131928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115327] [ENSMUST00000115330] [ENSMUST00000166445]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115327
AA Change: V227A

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110982
Gene: ENSMUSG00000029676
AA Change: V227A

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115329
SMART Domains Protein: ENSMUSP00000110984
Gene: ENSMUSG00000029676

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115330
AA Change: V227A

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676
AA Change: V227A

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
Pfam:POT1PC 152 299 6.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156985
Predicted Effect possibly damaging
Transcript: ENSMUST00000166445
AA Change: V227A

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676
AA Change: V227A

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Pot1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Pot1a APN 6 25744628 missense probably benign 0.01
IGL01393:Pot1a APN 6 25744631 nonsense probably null
IGL01411:Pot1a APN 6 25750144 splice site probably benign
IGL01774:Pot1a APN 6 25753277 missense probably benign 0.00
IGL01981:Pot1a APN 6 25750100 missense probably damaging 1.00
IGL02404:Pot1a APN 6 25764432 splice site probably benign
IGL02530:Pot1a APN 6 25794593 missense probably damaging 1.00
IGL02755:Pot1a APN 6 25771613 missense possibly damaging 0.81
IGL03127:Pot1a APN 6 25794616 missense probably benign 0.00
IGL03396:Pot1a APN 6 25745914 missense possibly damaging 0.93
R0329:Pot1a UTSW 6 25778831 splice site probably benign
R0359:Pot1a UTSW 6 25771680 splice site probably benign
R0530:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R0840:Pot1a UTSW 6 25748284 splice site probably benign
R0918:Pot1a UTSW 6 25756268 missense possibly damaging 0.92
R1650:Pot1a UTSW 6 25745965 missense probably damaging 1.00
R1937:Pot1a UTSW 6 25753324 missense probably benign 0.15
R2142:Pot1a UTSW 6 25750044 splice site probably null
R4072:Pot1a UTSW 6 25752357 splice site probably null
R4074:Pot1a UTSW 6 25752357 splice site probably null
R4322:Pot1a UTSW 6 25745930 missense probably benign 0.02
R4895:Pot1a UTSW 6 25753206 missense probably damaging 1.00
R4910:Pot1a UTSW 6 25746021 intron probably benign
R5530:Pot1a UTSW 6 25778894 missense probably damaging 1.00
R5748:Pot1a UTSW 6 25758856 missense possibly damaging 0.77
R5775:Pot1a UTSW 6 25757298 splice site probably null
R5870:Pot1a UTSW 6 25778951 missense possibly damaging 0.90
R6180:Pot1a UTSW 6 25771621 missense probably benign 0.00
R6377:Pot1a UTSW 6 25778870 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCATGTAATTTTAAAGGCAGCAAG -3'
(R):5'- ACTGCCTTTGGATAAAGAGCAC -3'

Sequencing Primer
(F):5'- TAATTTTAAAGGCAGCAAGGAATAGG -3'
(R):5'- CTGCCTTTGGATAAAGAGCACTAAGC -3'
Posted On2016-04-15