Incidental Mutation 'R4933:Svs1'
ID380714
Institutional Source Beutler Lab
Gene Symbol Svs1
Ensembl Gene ENSMUSG00000039215
Gene Nameseminal vesicle secretory protein 1
SynonymsSVS I
MMRRC Submission 042533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R4933 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48986861-48991722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48987492 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 145 (S145P)
Ref Sequence ENSEMBL: ENSMUSP00000045221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037696]
Predicted Effect probably damaging
Transcript: ENSMUST00000037696
AA Change: S145P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045221
Gene: ENSMUSG00000039215
AA Change: S145P

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 44 130 1.5e-24 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.7e-16 PFAM
internal_repeat_1 286 342 7.28e-22 PROSPERO
Pfam:Cu_amine_oxid 408 811 2e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203494
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Svs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Svs1 APN 6 48987739 missense probably damaging 0.98
IGL01876:Svs1 APN 6 48990036 missense possibly damaging 0.71
IGL01934:Svs1 APN 6 48988761 missense probably damaging 0.97
IGL03002:Svs1 APN 6 48987118 missense probably benign 0.01
IGL03059:Svs1 APN 6 48987415 missense probably benign 0.13
IGL03213:Svs1 APN 6 48988345 missense possibly damaging 0.92
IGL03249:Svs1 APN 6 48988369 missense probably benign
IGL03365:Svs1 APN 6 48988597 missense probably damaging 0.97
PIT4280001:Svs1 UTSW 6 48987120 missense probably benign 0.01
PIT4495001:Svs1 UTSW 6 48987776 missense possibly damaging 0.92
R0010:Svs1 UTSW 6 48988906 missense probably damaging 0.99
R0528:Svs1 UTSW 6 48988031 missense probably benign
R0784:Svs1 UTSW 6 48987301 missense possibly damaging 0.78
R0959:Svs1 UTSW 6 48988632 missense possibly damaging 0.89
R1173:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1174:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1175:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1940:Svs1 UTSW 6 48990073 nonsense probably null
R3115:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3116:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3808:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3809:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3852:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R4455:Svs1 UTSW 6 48987460 missense possibly damaging 0.56
R4898:Svs1 UTSW 6 48987717 missense possibly damaging 0.95
R5108:Svs1 UTSW 6 48988570 missense probably damaging 0.97
R5320:Svs1 UTSW 6 48987575 missense probably benign 0.02
R6053:Svs1 UTSW 6 48988488 missense probably benign 0.42
R6728:Svs1 UTSW 6 48988845 missense possibly damaging 0.86
R6922:Svs1 UTSW 6 48987574 missense probably damaging 0.99
R7045:Svs1 UTSW 6 48988612 missense possibly damaging 0.81
R7046:Svs1 UTSW 6 48987578 missense probably benign 0.11
R7137:Svs1 UTSW 6 48990149 missense probably damaging 1.00
X0022:Svs1 UTSW 6 48988339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAGATGCTGATGCCCAAG -3'
(R):5'- TGCGTTGCAAAAGAAACCAG -3'

Sequencing Primer
(F):5'- TGCTGATGCCCAAGAAGTATG -3'
(R):5'- AGCTATGGCGCTTTCCAAATG -3'
Posted On2016-04-15